Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12916  (registered. 2012)
Contig Information
Length 1444 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_VSCB Liquid cultured tissue 1
WH_XA Root 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222622536|gb|EEE56668.1|| hypothetical protein OsJ_06104 [Oryza sativa Japonica Group]
Score 437
Evalue 1.00E-120
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12916
AACGACTCTTGCCGCCGTGTACTGAGCTCCCGCGTCCGCACACCCGATCTGAGTCGTCCAATTCTGACCGGGCGGTGGCGGTCCAAGGCAGTCGGCGGGA
TCTTCTCTCCAACGAGCGCAGCCTCCATGATGCGCCGTACCTGATCGAACCGGCCGATGGTCCCGGGGGACAGCCGCGTGAGTCCGCCTGTCCTACCAGC
ACTGGTCGGTCTCCCACGTCCTCCGCCGGAACGCCGGCCCGGCCGCGGCCGCCCGCTGCATCATCATCCCCGCGGCGCCCTCGTGCCGAATTCGGCACGA
GGTTCGGTTTCCCCCATTCCCCTTCGCACCCCCGCGGCGGCGGNGCCTTCCCGGGCGCTCACCGGACACGCGCAACAACACTATGAGGAGGTACAGCCCC
CCACACCGTAGTCCCCCGAGGAGGGGATATGGTGGCAGCCCCGCGCATCGTAGTCCCCCAAGGAGGGGATATGGTGGCAGCCCCCCGCACCGCAGCCCCC
CAAAGAGGGGATATGGTGGCAGAGGAAGAAGCCCCCCTAGGAGGGGTGGATATGGAGGACGAAAGGAGCAGGGTTCTGGAAGTCTCTTGGTCCGCAACAT
CCCATTAAGCGCCAGAGCGGAGGATCTCCGTGTTCCTTTTGAAAGGTTTGGTCCTGTTAGGGATGTTTACCTTCCAAAGGATTATTACAGCGGGGAGCCC
CGAGGGTTTGCGTTTGTGGAGTTTGTTGACCCTTATGATGCCTCTGAGGCCCAATACCACATGAATCGCCAGGTATTTTTTGGCCGGGAGATAACTGTTG
TGCTTGCTGCTGAGTCACGGAAAAGGCCAGAGGATATGCGCACTAGAACTAGAGTCAGGGGGTACTCTGGAGGTCATGAAGGGCGCCGTTCCTCTCATTA
TGGGAGGTCTCGTTCCCGTTCACGCTCCGCCTCTCCCCGCCCTCGTGGCGGTGGCCGTGCTCGGTCAAGGTCATACTCTCCTGCTCCAAGACGGCGAGAT
GACTACTCTGCTTCCCCACGGGGAAGGGAGTCTCATCGCACGAAATCTCCTGTGCGTCATCCAAAAGAACATGAGGAGGACAAAAGGAGATCCTACTCTC
CCCCTGGTAGAGATGGTGACCAACGTGATGCTGATAACGGGAGGTCGCCACCGGCCGACAGTGATGGATCCCCTTCACGCCCGAGGGTGGCCAGGCCATC
CTCAGGATCGCCCCCTGGATCCCGCTCCAGGTCCCCCGACGCTTCTCCTGCCCGCAGCGACTGAGAAATTGGTTACATCCTCTGCGGTCGCCGCATCTCC
ATCTAGCTACTTCCATTGGTTCGAGTAAAACCCTTCGAGGTGTGTTGTATTGCTTGTTAGCGGTCACAGACGTTATGTTCCCGCTTGTTGCTGTTGAACC
TTAAGGCCTGTAGCATGGCGTGTCTGTCATATCTATGTACCATG
page-top