Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12897  (registered. 2012)
Contig Information
Length 812 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_PCDAM Anther at meiosis 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_SP 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218200153|gb|EEC82580.1|| hypothetical protein OsI_27132 [Oryza sativa Indica Group]
Score 248
Evalue 6.00E-64
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12897
TGCAACTCGCGCCCATGGGCTGTACAACACATTAACAAGTTTAACAGCATGACAAGTACCGCACACTTACACCTCACGAGGCGCACCCCATCCACTAGTA
CACTTAACCCAGCCACTGGTACACTTAACGACTCGGAGCATCGACTGAGTATGCAAAGACTTGTCGTTTTGATTATTACACTTAGCAAAGAATTGCTAGG
ATAGTTTTGATTATTACACTCCAAGTTAATCACGAGCCAGCCCATCACACATGGCGGAAAAGCCCCTAGGCAAGGTCGACCAAATCACCTTCACTAAGAT
TAATGCAAAATCAGTCTTTATTTCTTCAATATCATGCCCGTGCATTTTCGCCTTGAAAGAACAGCAATGTTGGTCGGAACTGGATGACAGTGCGCCTACC
TTGAACTTCAAATCTATCGAAGAGTTTTTCATTACAGCAACCACGGACCTCTTTAGGCCTTGTGAATCAGCGATGGTGCCATCAAAGAGCTGGATTTCTT
CATTAAACCCACTGGCTAAACATCCGACGGACAAACTGAAACTGCTTTTCACTTCCAATATGAGAACCTCTACGGTCGCCTCAACTGCTTTTAAAAGGCG
TGACAAAGTTATGTCAACTGAGCCACAATCACCAGCAATGTGAAATGTGCATGGTTGATCCCATGAGCCTAAGGGGCCTATGAATGATGCACCATCAATC
AGCTGTAGGTCATTTTTTTCTTGTTCACCTGACTTGATCTTCATGTCATATTCAAGTAGAGCATGATCTGCCATATCTATCCCTCGCTTGGGGCCAATCA
TGTTGATGAGAG
page-top