Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12852  (registered. 2012)
Contig Information
Length 1136 bp
Clones alternative view 158 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 1
Wh_SH - 27
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 25
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 3
WH_SP 1
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 5
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 22
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XV Leaves, plant was grown at constant 23Ž 5
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 11
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 11
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 22
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226502967|ref|NP_001142284.1|| hypothetical protein LOC100274453 [Zea mays]
Score 505
Evalue 4.00E-141
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12852
TTTTTTTTTTCAGACAACTTCAGTGTTTGACATTGAGAGGTTCAGAGAGTTTTTTTTTTAACCAGAAGAACAGAGATGCCTTGATTAATCTGAGAAAATA
GCCAGATATTACACAAACACCATCTTGTAGTGTACACACACCAACTCCTCATCTCGACTCGCCCTCACATGCAACATCTATCAGTCCGGACTACTCAATC
TCAGAACGGGAAGAAGCAGAGATCGACGACGACACACATGCAGCAGCATCCATCAGCCATGAAGTTGTCGGCCTAGAGCTTGAGCTGACGGCGCTCACTT
GCCGGGGACGAAGTTGGTGGCGAAGGCCCAGGCGTTGTTGTTGACGGGGTCGGCGAGGTGGTCGGCGAGGTTCTCGAGGGGGCCCTTGCCGGTGACGATG
GCCTGCACGAAGAAGCCGAACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCCGCGAAGGCCTCGGGGTCCTCGGCGAGGC
CCAGGGGGTCGAAGCTGCCGCCGGGGTAGAGCGGGTCCACGATCTCGCCCAGCGGGCCGCCGGCGACGCGGTAGCCCTCCACGGCGCCCATGAGCACCAC
CTGGCAGGCCCAGATGGCGAGGATGCTCTGCGCGTGCACCAGGCTGGGGTTGCCGAGGTAGTCGAGGCCGCCCTCGCTGAAGATCTGGGAGCCGGCCTTG
AACCAGACGGCCTCGCCGAACTTGACGCCGTTGCGGGCGAGCAGCTCGGGGAAGACGCAGCCGAGCGCGCCGAGCATGGCCCAGCGGCAGTGGATGACCT
CCAGCTCCCGGTTCTTGGCGAAGGTCTCGGGGTCGGCCGACAGCCCCGCGGTGTCCCAGCCGTAGTCGCCGGGGAACTCGCCGGTGAGGTAGCTCGGGGG
GTCGCCGGAGAGCGGGCCGAGGTAGAGCACGCGGTCGGAGCCGTACCACGGGCTGCTGGACGCCGCCACCTTGGGCTTGCCCGCCGTCTTGCGCATGGTG
ATGCGGCCCTCGCCGAAGGGCGCCGCCCTGGAGGCCTTCACCGGGGTGCCGGCCATCGCCGGGGAGGAGAGCGCCATGGTCGCGGCCGCCATCGCGCGCT
GCGTGCTAGCTGGCTTTGCTTCGGGTGAGCTGAGGC
page-top