Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12848  (registered. 2012)
Contig Information
Length 799 bp
Clones alternative view 25 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_r Root 1
Wh_VSCB Liquid cultured tissue 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XV Leaves, plant was grown at constant 23 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig12848
TTTTTTTTTTGAACAAAAGACGGGTCCAGAAGGACCCTGATGCTGCATTAACACTGAACATGAAGTACACAGCATTTTACAGACGGACCCAGAACTAACT
GCAAATAACACACTGGTCCCTGTCTTTTACAAAGAGGACCCCAACAACCAGATAAGAAAAGCAATCGGGTCCTTGACATCTTCTGCACGGCCGTAACTTC
GCCGTCGCCGGGGACATTGCCACTTGGGACAACTAAGCTTCCATGGCACCACGCCATAGACTCCGTGCAGAAGATGAGCTGCCTCCCTTTAGGCATCTTG
GCCGGGAGGAAGAAGTAGAAAGGCCGCCCTTCGGCCAGCATGTACGATGACGTGATGGAGCCGGCCGGCCGCCGAACGCCGTAGCTGGCGCCAAGGCCAC
TCCCAAACAGCCACCGGATAAGAGCACTGACCCGATCTGGTTCTCCATCTCTTCTACTCTTCGTCTTCACCACCACGGCGACGCCACGAGCTAGAGAAGT
AGCGGAGAGCCTCCAGAACAGGGGACCAGACGAGCTTATTGGTGGATGAGCCAGCAGCACGCCCCTCGGCAGCGACTGGCCGCCAGCCAGCCTTGCCTGA
GACGCAGCCACCGTGAGCCACCAGCCGCTGCTCGTACGCGGCGGCGGCGCTCTCCACATCGGCATACAGCCATACGCCACATGGGCACTACTCGACCTCA
ACCTATACCTAGATTCTATATACATAGGACAACCCCATGCACCTCTCCCGTCTCCGCTCCGGCCGGCGTCGCCGTCGGAGAAGATAAGGGATCGGGCCG
page-top