Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12836  (registered. 2012)
Contig Information
Length 1248 bp
Clones alternative view 45 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 1
Wh_EM Dormant seed with water absorption 1
Wh_PCDAM Anther at meiosis 4
Wh_SHC Shoot grown with cold treatment 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VWD Shoot grown with dessication 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 5
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_SP 1
WH_XB Root 6
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226529563|ref|NP_001149191.1|| alpha-soluble NSF attachment protein [Zea mays]
Score 538
Evalue 7.00E-151
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12836
ATCCCCTTCCTCCTCTCCCTTCGTTTTCTGCTCCTCCCCCGCAACAAATCTTGTCGCTTCGCCGCCGGCACAAGCGATCGGAGCAGCGGCCCGTCGGCAG
CGATGGGGGACCACGAGGCGCGCGGTGACGACACGGAGAGGAAGGCGGATAAGAAGCTCTCCGGCTGGGGGCTCTTCGGCTCCAAGTACGAGGACGCCGC
CGACCTATACGATAAGGCCGCCAACTTTTTCAAGCTTTCGAAGAACTGGAACAGAGCTGCATCTGTGTATATCAAGATTGCTAATTGCCATCTGAAGGGT
GATAGTAAGCATGAAGCTGCCTCAGCTTATGTGGAAGCCGCAAACTGCTACAAAAAATTCTCACCTCAGGAAGCTGCGCAAGCGCTAGACCAGGCTGTTA
ATCTTTTTCTGGAAATTGGTAGATTGAGCATGGCTGCAAGATACTGCAAGGACATTGGTGAGATTTATCAGCAAGAGCAAGATTTGGAGAAGGCTTCAGA
TTACCTAGAAAGGGCCGCTGATCTTTTCGACAGTGAAGGACAGACATCTCAATCAAACACCATTAAGCAGAAAGTTGCAGAAATTGCTGCGCAGTTGGAA
CAGTACCCAAAGGCAACTGAGATTTTTGAAGAAATTGCTCGTCAATCAATTAACAACAATCTGCTGAAGTATAGTGTCAGAGGCATCCTCCTTAATGCAG
GGATCTGCCAACTATGTAGAGCTGATGCTGTTGCTATACAAAATTCATTGGAGAGATACCAGGAAATCGACCCGACTTTCTCAGGAACTCGTGAATACAA
ACTTTTAGCTGATCTTGCTGCATCAATGGATGACGGAGATGTTGCCAAATTTACTGATGCCATCAAGGAATTTGACGGCATGACACGCCTGGATCCTTGG
AAAACGACACTGCTGCTGAGGGCAAAGAATGAGCTGAAGAAGCAAGAGGACGATGAGGATGATCTAACCTAAGCCTTATTGTAAAAATTCTTTCATGCTT
CAACATGGTGTGATTTATGCCTCTATTTCGTCTTGGAGGTACATATAATGGGCATAATGAAGATCCACCTTTTGGTTGTATAGAACTTCATTTTGAAGTA
CCATATCAGGTGTCGTGTGTCATTTGTTCTTGTCATGACTTGGTTTTCCGTCCGAATGAAAATACCATAGCACGCTGTTGCTGCTATCCTTCTGTAAAAA
AAAAAATTTCGCCCTCATTAATGACTTTGCTATTTTCCAAAAAAAAAA
page-top