Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12832  (registered. 2012)
Contig Information
Length 1252 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 1
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 1
Wh_PCDAM Anther at meiosis 2
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XA Root 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|219885633|gb|ACL53191.1|| unknown [Zea mays]
Score 657
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12832
TTTTTTTTTTACCAACGAACTAGAATAATATATTACTTAGACGTGACATCGTGGCCCATTTAACCCACGAATGTTCCAACTCGCACTGGAATAACTCCGA
CCACCCGGAGCGAAACAATAACCATCACAACCTCAAGTCTCAGATGACAGACACGACATAATAATACTGTAACTAGCAGCAGGCTTCACCGCCTCTGTCA
CAGAACATCGACTGTTTAGTCAACCTCCTCGATCTTGGGGCCAGGGCCGCCGGACGCAGCTGGGGTATCGTCGTCCATGCCGCCCTCCATGTCAGCACCA
GCACCCTGGTACATCTTGGCGATGATGGGGTTGCACAGGGCCTCCAGCTCCTTCATCTTGTCCTCGAACTCGTCCGCCTCAGCAAGCTGGTTCGTGTCCA
GCCACTGGATGGCAGCATCAATGGCATCCTCGATCTTCTTCTTGTCGTCCGCCGGCAGCTTGGAGGCGACCTTCTCGTCCTTGATCGTGTTGCGCATGTT
GTATGAGTAGTTCTCCAGGGCGTTCTTGGACTCCACCTTCTTCTTGTGTTCCTCGTCCTCGGACTTGTACTTCTCAGCCTCCTGGACCATCTTCTCGATC
TCCTCCTTGCTCAGCCTGCCCTTGTCGTTGGTGATGGTGATCTTGTTCTTCTGCCCAGTCGTCTTGTCCTCGGCAGACACGTTCAGGATACCATTGGCGT
CGATGTCAAAGCAGACCGTGATCTGGGGAACTCCCCTGGGAGCAGGAGGGATGCCAGACAGCTCAAACTTGCCAAGAAGGTTGTTGTCACGGGTCCTGGT
CCTCTCACCCTCATACACCTGGATGAGCACACCGGGCTGGTTGTCCGAGTAGGTGGAGAAGACCTGCTCCTTCTTGGTGGGGATGGTGGTGTTCCTTGGG
ATCAAGACTGTCATCACACCCCCGGCTGTCTCCAGACCAAGAGAAAGAGGGGTGACATCCAATAACAGCAGGTCCTGGACCTTCTCGTTGCCCTCTCCGC
TCAAGATGGCAGCCTGGACAGCAGCCCCGTAGGCAACAGCCTCATCAGGGTTGATGCTCTTGCACAGCTCCTTGCCGTTGAAGAAGTCCTGGAGAAGCTG
CTGCACTTTGGGAATCCTGGTGGAACCACCGACAAGGACAACATCATGTACAGTGCTCTTGTCCATCTTTGCATCCCTGAGACACTTCTCCACAGGCTCC
ATACACTTCCTGAACAGATCCATGTTCATCTCCTCAAACCTGGCCCGGGTGA
page-top