Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12805  (registered. 2012)
Contig Information
Length 741 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 1
WH_XA Root 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242049798|ref|XP_002462643.1|| hypothetical protein SORBIDRAFT_02g029440 [Sorghum bicolor]
Score 209
Evalue 2.00E-52
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12805
TTTTTTTTTTGATTTCAAAGCTAAGAATATTACAAGCAGCAAATCATACATAGCACACTTTCTTACAGACTGTTCCAATAATAAATATATACACACAGAT
TGACAATCCAAGCCACGCAGCAGGAGTTAAATCTCTTCTGTTATTTTCTTTGCTTACTTAAAACACCAAACGAGAAGCACATCAAAAGGACCGACGCCCT
TCCAAGATGAAACGGACACGGGTAAGAAAGCATTGGCATATAGTACACCCTAACTGAAAGGCACATGATCGCAGGGTACTCAGGAAGGCCGTTCTTCATT
CTGTAGATCAGACAGGGTCGTTCGTTGTTGAGATCAGACCCAGTGTGGCGTCAGAAAGCGGCGTTCGGTTTGCTAGTGAGTTCCACTGGTTGTGCCGTGG
CCACTGCTGACCGAGCCCCAGTTAGTTTCTCCACCTCCCATCTGCACGGCAATGCTGTCCATCGACTCTGAGGTCCCACTTCTGTGACCCCAGCTTGATC
GTCTCGAATGCATACCAGCCCTACCTTCCATGAGCTCAACTGGAAGGGCTTCTCTGCTGAGATCAGGTGACGCATGGGTTATTCTGCCTTCTTTCTCATC
CAACATGCCCCCAACTTCTAAATCTCTTAGATCAGCTCCTGACCGAGGTTCGTCCCATGATACTGGCTTCCTGCCCAATTCAAGGTCTCCAACAGGTTTG
CCCATGTTTGGGCTCATGAAGCCCCTGGTTGGTGGGCGTGA
page-top