Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1280  (registered. 2012)
Contig Information
Length 1542 bp
Clones alternative view 15 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_EM Dormant seed with water absorption 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 3
Wh_VWD Shoot grown with dessication 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|61658230|gb|AAX49504.1|| UDP-D-glucose epimerase 1 [Hordeum vulgare]
Score 652
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1280
GTCGACGGGCTTGGTGCAGTCGATCACGAAGNNNNNNNACCCCTTCTTCTTCCCGGCGCCCGCGCCGCCCTTGGTAGCCGCCGCCACGCCGCGCGCCATC
TCGGTCTCCGCCTTGCCCGCTCTCCGGAGTCTGCTTCGGTGGTGGCTGCCTCGTGCCGAATTCGGCACGAGGAGTTATTCCATGACCGACAAGATATCTA
TATATATATTTCTACAAGGCAAGGGAACCAACCTTATTTCTTCTACTTACTCCATAAGGGAGATGGATATGATTAGCTTTCTAACACGAACAATATAATT
AATTATAAGCTACTGATGGATCCGACTCACTCACTCACTCCCTATACACATCAGTAGTAGTCTTCCTCTTCTTCTCTCTGCTCTCTGTGGTGGATAAATA
TATAGATGGATGGTGGTGTATATATGCTACTGCTACTGGCTCTGGGGTCTATTAATCAGTGGCCGTTGTCGGTGGATCCGTAGCCGTAGGGGTTCTTGCT
GGCCCAGTTCCACAGGTCTCTGCACATCTCCTCCACCCCATACTTGGCCTTCCACTTGAGCTCCTTCTCAGCTTTGGCGGTGGCAGCGTACACAGTCTCG
GCATCTCCAGCTCTTCTTCCAGCATAAACCAGAGGGATTTTCTTTCCGCAAGCCTTCTCGAATGCAGCAACCATTTCCAGCACGGACGTCCCCTTTCCAG
TGCCCAGATTGTACACCTCGCACCCTATTCTGTCAGAATCTTCGTAGAGCTTCCTCAGGGCGGCGATGTGGCCGTCAGCCAGGTCAACAACATGGATGTA
GTCACGTACCCCTGTTCCATCCTTGGTGTTGTAGTCGGTCCCATAAACCGTCAGCGCGGGCCGCCTCCCGACAGCGACTTGCTGGACATAGGGCATCAGG
TTGTTGGGGACTCCGAGGGGGTCTTCCCCGATGTAGCCACTCGGGTGCGCGCCGACCGGGTTGAAGTACCTCAGCAGGATGATCTTCCAGTCGGGGTCCG
AGCGCTGGAGGTCGCGGCAGATGTCTTCAATGACAAGCTTAGTTCGGCCGTAAGGGTTGGTCGCGGAGAGCGGGAACTCCTCGGTGCAGGGCACCTCCTT
GGGCCACCCGTACACAGTGGCTGATGATGAGAACACAAGCTTGTTGCATCCATGTGCTGCCATGACTTGGAGGAGGGTGATGGTGCCGATGAGGTTGTTG
TCGTAGTAAAGCAGGGGCTTCTGCACGCTCTCCCCCACGGCTTTCAGCCCGGCAAAGTGGATCACAGCCTCGAACCTTTGGGTCGAGAAGATTTCGTCCA
GCGCCTCCTTGTCACGAAGGTCCACCTTGCGGAAGTCGAGGCTGTCGACGACGAGGACGCGGAAGCCCTGGAGCAGCAGCTGCAGCACCGTGTGGCTGCC
GATGTACCCCGCGCCGCCCGTCACCAGGATCGTCCGAAGCACCGCAGACACCATCTTCTTCTTCCTCTGATTCCTCTTCTTCTTCTTCTAACTTGTAATT
CGACCGACGGGGCGAGATTGGAATGGGAGACAAGAGCGGTTT
page-top