Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12769  (registered. 2012)
Contig Information
Length 1172 bp
Clones alternative view 22 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_h Spike at heading date 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VABA Shoot with ABA treatment 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|194338899|gb|ACF49366.1|| cystatin [Triticum aestivum]
Score 473
Evalue 1.00E-131
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12769
TTTTTTTTTTGCAGAGTAACCGAAATTGACAGTGTATATTGCAGAGTAACCGAAATTGACAGTGTATATCGCATCCAACGGTACCCTCGAGTTACAAGAT
TGGTTGCACATTCCACCATTAACAGCAACCAAATAAGGTTCAGCTAGCAAGAACACATAGTTCCATCGTGCTTCATTCAACAACCGCCGGTGCAGAAAGC
ATAATATCCATGTAGAGACAGGTTTACTGTTTATTTCTTAGTACAAACTACATTACTGTGAGCTCAACAAGTCAGATTCACTGGCTGCTAGATTCGTCAT
GCTCTGGCTGCATCTGGTTCAGCACAAAAGCTCCCTCGAGGTTCTTATGCACCTCGGCTTTCATTTTCTCCTCCTTGGTCCCTCTCTTCAGTTTCATGAG
GATATCAAACTTCGCGAAGTCTTCAACCACCTCAGCCTTTGCACGAACGATTTCAACAAGTTCATATGGGAGAAGGGAATTCGACCTCTGCTGGATTGAT
TTCACAGCATGGCTTGCAGCATCTTTGACTACAGGATCATGCACAGGCACATCACGCCATCCAGGCTCATGTCCCCCTCTCTTGGCGCCGAGGTCGGAGA
TGGTGAAGGAGGTGGCATCCCCGGTGTGGCGGAACTCCTGCAGCTCCTTGAAGTCGAGCCACGGCTTGACCCAGACCTCGGCCTCGTACACCTTCTTCCG
CCCGGCCTCAAGCGCCTCAAGCGTGAGGTGGTGCAGCGTGCCGGCCACCGTCTGCTCCTTGGCCTCCACGACCCGTACGAACTCCAGCAGCGCGTTCTCG
CGCTTGTTGTGCTCGTCGACGGCGAAGCGGGCGAGGCCGTCGGTCTCGAGGCTGTTGGCCGCGTCGGGGTTCTCGCTCTTGCCGCCGAGGACGTGGCTGG
CCATGGCTCCGATGGCGAGCGAGGCGGAGCCGACGAGGAAGAGGAGGGCTAGAGCGGCGAGGAGGGCAACGGGAGCGGAGGAGGCGGGCCGCGTCGCAGC
AACGCGCATGCTCTGCCGGAGGAGTCCTTTGCGGTTTCGCTTTGCTTCGCGATGACTGCGTGTGCGTGGGTGGGGTTTGGATTCTGTACCGAGGAAGGGA
GAAGGAACCGAAGTAAGCAACGCAAGGGGCGTGGAGTCGGGGTCTCGTCCCTCCCTCCCGTCGGCGCGGGTC
page-top