Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig127  (registered. 2012)
Contig Information
Length 1296 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 4
Wh_CSEC Callus 3
Wh_VSCB Liquid cultured tissue 1
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|169730542|gb|ACA64837.1|| SKIP interacting protein 22 [Oryza sativa]
Score 516
Evalue 1.00E-153
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig127
GTGGGCACGCAAAGCAAAATTACAGGAACCGCAAGCCACTGTTCGGTTCATGACACTGACAGTTACACACACATACATAGGTCTTGTTCCCGATCAACAC
GGGAAGGAATGCCAACTATGTTTCGGTTCACGGCAACAAACCTCAGATCAGGTTCTCAACAAAGATGCAAACCATACATACCATAGCTAGGATGGGTACA
TAGATAGATAACTGAACCATACAAAACGGACAGACGACAGGAAGGTCTTTTGCTCAAGCAGCAGATGGGTAGATGGCGGTCACAGGAAGGTCCAGTTGAC
GAACATGAAGGCGAGGCAGTGTGGGGCGCCCGCCACGTCGTCGCCCACCACCTTCCACGCCACCGCCTGCTCGTACGACACCTGCCGCCCCATGCTCGAT
TTGCACACGCCGCCAGGGAGGTACGCGAAACCCTGCTGCATGACCTTGGAGAACTCGGCGCACAGCGCCTTGCGCCCCTCATCGTCCAGGATCGCCTCCA
GCGAGATGTCCTGCAGGTTCACCAGCGTCGTCTCCAGCATATCCAGGGCCGCGTTGTTACCAAACGTGAACATCGGAGCAGGCTTCAGAGAGCAGCAGAG
TATAGCGTCGCTGTGGTTCCACAGGAGCTTCAGGGGAGAGTCGGCTTCTTCAGTGTCCGACCAGCGGATCTCTTCCCCCGTGTGAGCCCTGTAGCTCCTT
CCTATCCAGCTAGCAAGTGTAAGCGCCTCGGGAGAGCCTGGAGGGTGCTTCAGTTGGATCTGCGAGCCGCCGAGGCGAGAAGGAGCTATCGCCATGGCCA
CCCTCTGAACCGATGCCATTACAGCCCTCACATACTGCCTTGCCATTGCTGCCACGCTTTCGCGGAGGTGGTTCTCGAATGAGAACTGGAAGGCAATGGT
CAGGACCGATCGCGTACTGCACCCACCTGGGGAGTCACCTGAACCACGCAAAGCTCCACCTGATCCAACATCAAGGGCGGACGCGAGGTCGAGTGTGCGT
GTGGCAGATGGCACATCCGTCTTTGTGTCCAGTGGTATAACACGGAAGCCTGAGGGTAGCAGCGGCGCATCATCAGCAAAAGATTCATCTATAGGTGCAA
AGACAAGCTGCGCGCAAGCGCCTGAAGCATTCTCATCAACACCGCTGCAAAGCTGCAGAAGGTACATATCTCGTGCAAGAAGCACCTCGTCGTGGCTAAA
ACCAGGTCCTTAGGCTCCAAGGTGTGTGCGAGTGGCAGTATAACCTGATTTCCCATGAACCCACCAGCTCTTAAACCTGGAACCGCATATGGGCTG
page-top