Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12688  (registered. 2012)
Contig Information
Length 1340 bp
Clones alternative view 129 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 1
Wh_r Root 4
Wh_yd Spikelet at late flowering 1
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 7
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 6
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 3
WH_XB Root 6
WH_XC Root, treated at 50 microM Al for 6h 19
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 16
WH_XF Seedling, infected with leaf rust 18
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XV Leaves, plant was grown at constant 23 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 5
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|2266662|emb|CAA74592.1|| 14-3-3 protein [Hordeum vulgare]
Score 507
Evalue 1.00E-141
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12688
GCAGACGCAGGTACCCAGCCGTTTCCTCCTCAAATCAAATCTCACCGCCGCATCCCTCAATTCTCCTCCGATTATCGTCGTCGTTTGACTAGATCTGCGG
CGACACACGCAGACGCAGATTTGGCATTCAGAAAAAATTGAAATTGTGAACTGTGAAGATGACGGCACCAGCGGAGCTTTCCCGTGAGGAGAATGTGTAC
ATGGCTAAGCTCGCCGAGCAGGCTGAGAGGTACGAGGAGATGGTTGAGTTCATGGAGAAGGTGGCCAAGACCGTCGACTCCGAGGAACTCACTGTGGAGG
AGCGCAACCTGCTCTCTGTTGCATACAAGAATGTGATTGGAGCCCGCCGTGCCTCATGGCGCATCATCTCCTCCATTGAGCAGAAGGAGGAGAGCCGTGG
CAACGAGGACCGGGTCACGCTCATCAAGGAGTACCGTGGCAAGATCGAGACTGAGCTTAGCAAGATCTGTGATGGCATCCTCAAGCTGCTCGAAACCCAC
CTTGTCCCGTCTTCCACTGCCCCTGAGTCCAAGGTCTTCTATCTTAAGATGAAGGGTGACTACTACAGATATCTTGCCGAATTCAAGAGTGGGCCTGAGA
GGAAGGATGCTGCTGAGAATACCATGGTGGCATACAAGGCTGCTCAGGATATTGCTTTGGCTGAGCTGGCTCCAACTCATCCGATTAGGCTTGGGCTGGC
ACTGAACTTCTCGGTGTTCTATTATGAGATCCTCAACTCGCCTGATCGTGCTTGCAATCTCGCAAAGCAGGCATTCGATGAGGCCATTTCGGAGCTGGAC
ACCCTGAGCGAAGAATCCTACAAGGACAGCACCTTGATCATGCAACTCCTTCGTGATAACTTGACCCTCTGGACTTCTGACATCACGGAGGACACCGCGG
AGGAGGAGATCAGGGAGGCTCCAAAGAACGACTCGAGCGAGGGGCAGTAAAGCCGGCTTTGCGACGCCCCGCAAGCTCCTAGCTAGTGTTTGCTACTGTC
AATGACATTGCAATGTGGTCTGGATATGTCGTAGCCGTGTTATGGTTGTTGTCGCAAGATTTGAGGCTCCCCCGTATGTGATGTTGCCGGGGAAGGTTGC
TGTCGCCGCTTGTAGCGTAGCAGGCGGTGGCTGCCTCCTGGTCTGGCTCGGGAGGGAGCCCCATAGACTGGTGGTGGTGGTGGCCGTTCGTACTTTCGTT
CTGCCTTAATATTGCTTCTTATCGTGAGTGGTAAAACGTCAGTGTCTTGCCTGTTCTGTTTCGGTTCTTTTGGTGATTTTCCGTGGGGAGTACTCTCATT
TGGGGATTGGCCGGATTGTTTGCTCCGGATAAAAAAAAAA
page-top