Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12642  (registered. 2012)
Contig Information
Length 1138 bp
Clones alternative view 21 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_KMP Shoot grown under continuous light 2
Wh_PCDAM Anther at meiosis 2
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 3
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|290875537|gb|ADD65763.1|| putative carbonic anhydrase [Triticum turgidum subsp. durum x
Score 420
Evalue 1.00E-115
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12642
AATCCATCCATCCATCCATCGGGGAGAAGAGAGAAAACCCAAAAGAGTAGAGTCGCGAACGCGAGCGCGATAGTTGAAGATGAGCGGCTGCCTGTGCCTC
CCCTGCTGCTATAAGAAGCCCTCCGCCCCCGGTGGGGAGAACACAACTCCCCCAGCAGCAGCGATAGATTCTTCCTCCTCGTCACTCCTCCAGAAGCCTA
CCTACCATCCACCACCTCCTCCACCCTCCAACAAGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAA
GAAGCCCGATTTCTTCGAGCCCCTCAAGGCCGGCCAGGCGCCCAAGTACATGGTGTTCGCGTGCGCCGACTCCCGTGTGTGCCCCTCGGTCACCCTGGGC
CTGGAGCCCGGCGAGGCCTTCACCATCCGCAACATCGCCAACATGGTCCCCTCCTACTGCAAGAACAAGTACGCCGGTGTTGGATCGGCCATCGAATACG
CCGTCTGTGCTCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCTCTGCTCTCACTCAAGGATGGCGCAGACGACTC
CTTCCACTTCGTCGAGGACTGGGTCAGGATCGGCTTCCCGGCCAAGAAGAAGGTGCAGACTGAGTGCGCCTCCATGCCTTTCGATGACCAGTGCACCGTC
CTCGAAAAGGAGGCAGTGAACGTGTCCCTCCAGAACCTCCTGACCTACCCGTTCGTCAAGGAGGGTGTGTCCAACGGAACCCTCAAGCTGGTCGGCGGTC
ACTACGACTTCGTCTCCGGCAAGTTCGAGACATGGGAGCAGTGAATCTTCCCCAGCGGTTAACTCCTATATATACATGCGAATGCAAACGCGTACATATA
TCAAGATATCGTCCGACCGACCGATGTGAATCCAATGCCATGGAGTGCGTACTCGTTGTTTTCCAGTACTGGATGCCGGGATGGCCCGATGTGAATTCGC
CATAAGCAATAGAACCCTTTTTCTTTTACCATTTTCTGACGAGGAATTGTACTACCCGTGTGATGCATAATTTGATCGTCCTGTGATCAAAAGACATCAT
ATATAAGTTTAATAATATTTTCATGAACAGTTAAAAAA
page-top