Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12597  (registered. 2012)
Contig Information
Length 823 bp
Clones alternative view 22 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 1
Wh_OKCS Seed DPA5 1
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115458618|ref|NP_001052909.1|| Os04g0446300 [Oryza sativa (japonica cultivar-group)]
Score 352
Evalue 4.00E-95
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12597
CACGAGGCGGCCCATCTCCTCCCCCTCGACGACGGCGCAGATGGCGAGCGACGGCGCGGTGGCCACGCCGGCGAAGGTGACCCCGAAGAAGGCCAACCTC
CTCGACCCCCACTCCATCAAACACCTCCTCGACGAGACCGTCGCCGAGGTCGTGAAGGGCAAGGGCTATGTGGAGAACACGCGGCTGGGCAACTGGAAGC
TCCTGATCGGGACGGCCGTGATAGCCATCGCGCTCCTCGCGCAGTTCTACCCGAAGAAGTTCCCGCAGAACCGCGAGTTCCTTCTCGGTTGCATCGCGCT
GTATGTGGTGATGAATGTGGTGCTGCTGATCCTTAGCTACACCAAGGAGAAGGATGCCATCATCTTCACCCACCCTCCTGCTGGTTCTTTCAATAACACT
GGCCTTGTTATATCTTCAAAGTTACCAAGATTCTCGGACATGTACAATCTTTCAATAGCCAGCGCAGATCCAGAGTCTATCTCTGCTCACAAGCCCGTCC
ACTTCACTAAGAGTGTTACAAAATGGTTTACAAAGGAAGGTGTTCTTGTGGAGGGCCTGTTCTGGAAGGATGTTGAGAGACTCATTGATGACTACAACAA
CGAGCGCAAGAGCAAATGAATTACTGGCCATTGTCATCATTATCAGGATGAAGCTTAGCCTAATCGAAATAGACAATGTTTTTGATAGCAGTACTGTTTG
AACTGGTGAATGAAGCACCGTTAAGATAATACATCATTGCAGTCTTTTTTTCTTGGTATACAGGTCTATCTATAATGGTTATATCACCGTGTATCCCAGC
GTTTTGACTTGCCAAAAAAAAAA
page-top