Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12595  (registered. 2012)
Contig Information
Length 971 bp
Clones alternative view 58 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_r Root 2
Wh_CSEC Callus 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_RDr Root of dessiccated seed 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 9
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XC Root, treated at 50 microM Al for 6h 8
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|585032|sp|P38076.1|CYSK_WHEAT|CYSK_WHEAT RecName: Full=Cysteine synthase; AltName: Full=O-acetylserine
Score 417
Evalue 9.00E-115
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12595
GTAATTGTCAGCCCCGTTATAGAAAAGGAAAACAAAGATTTTTTTTTTTATGGCACCATGATGTTTCATTTCACACTGGCTGACATATGGACCACAGAGG
AGTTCAATATACAGGGCATGCAAGAGGTAATTCAAATCGCTAAACACCACAAGGCCAACACAAAAGTATTCCCCATTGCTAAACAAAGTGGGATTAAAAC
TTGACAGGACTTGATGTCAGACCAACACTAGCAGGGACGCCAAAGCTTTTATTTCTGTAGGAGGGCTCCTACGAATGTAGGGATTTGGCTTTGGAGAACA
GCTTCGCGCGCTTGAGGAGTCCCGAGAGTCACTCGACCACCATGCTCTCGGCCTCCTTCTTGATGGAGTGGAAGAGCACCGACGAAAGGTAGCGCTCTCC
GAAGCTTGGGAATACAACAACAAAGAGTTTCCCTGCATTTTCAGGCCTCTGAGCAACCTTGATTGCAGCTGCTGCAGCAGCACCAGAAGAGATTCCAACC
AGCAATCCTTCTTTCAATGCCAGAGACTTTGCCATCTCAATGGACTCATCACTTGAAACCTGTATGGTTTCATCAATGATGTCAACATCCAAGACACCAG
GGATAAAACCAGCTCCAATTCCTTGGATCTTGTGTGGTCCAGGCTTTCCACCATTTAAGATAGCACTCTCGGTAGGCTCCACACCGTAGAGCTTGATGTT
AGGATTTTGCTCTTGGAGGTATTTTCCAGTTCCAGTAATGGTACCACCTGTCCCGATGCCAGAAACAAGGCCATCGATCTTTCCTCCTGTGCCTTTCCAG
ATTTCAGGCCCAGTTGTCTCATAATGAATCTTTGGGTTGGCAGCATTCTCAAACTGCTGAAGGATGTATGAGTTGGGTGTCTTTGCTGCCAGCTCTTCTG
CCTTTTGGACAGCTCCTTTCATTCCCAAGAGTGGGTCGGTGAGGATCAGCTCAGCACCAAAAGCCTTCAAG
page-top