Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12588  (registered. 2012)
Contig Information
Length 888 bp
Clones alternative view 97 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
Wh_SH - 3
Wh_DPA20 Seed DPA20 5
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHC Shoot grown with cold treatment 4
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 3
Wh_VWD Shoot grown with dessication 6
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 4
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 8
WH_XN Leaves, plant was grown at constant 23 5
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 16
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XE Seedling, infected with leaf rust 7
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 14
WH_XV Leaves, plant was grown at constant 23 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226505420|ref|NP_001145325.1|| hypothetical protein LOC100278648 [Zea mays]
Score 179
Evalue 5.00E-43
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12588
AAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCTCCAAGGCCAACAGGTTCACGGTCATGGCAGCGGAAAACATCGACGAGAAGAGGAACACCG
ACAAGTGGAAGGGTCTTGCGTACGATATCTCCGACGACCACCTCGTGCCGAATTCGCTACTAACCTCACTACTCTTAAGCCACAAAAGATTTTGCTACCG
GCACCTAAGCTCCAATGGAGGGTGAGAAGAACTCGTCCGGGGACCTGATGTCCAGCAGCAAGCTGGTCGCGGAGGCCGCCAAGACAGCCTACGAGCAGAA
GAGCGTCGAGGGCATCGACAAGGAAAAGGTAGCCGGCGCCTCCGCCGAGATGCTGGACTCCGCCGCCAAGTACGGCAAGCTGGAGGACAAGCCGGTGGGA
CAGTACCTCGAGAAGGCCGAGGGGTACCTGAAACAGTACAGCTCCGGCGGCACCGAGAAGGAGAAAACCGACGCACCTGCTGCCGCTGACGCACCGAAGC
CGGATGCACCCAAGGAGGCAGCGCCTGCACCCGCCGCGGAGGAAGAGAAAGCGTCCGATGGGTTCGGTCTCGACGACGTCATGAAGGGGGCTGCATCGCT
GTCCGGGAAGAAGAGTGGCGAGGAGGAGAAGGAGAGCGGCGGCGGCGGCGGGTTCATGAAGATGGCTCAGGGGTTCATGAAGTAGAAGTCTGGTTTCTGC
ATCTACATGCATGTAGCTCTCGCTAAGTTTGTGCGCTGCGTTCTACTGTATAACGTTGTGGTTGTGCTTAATTATGTTAGCTGGTGATATCTGGTTCTGT
AAAGTTTAAAGTTTCTTAAGTCATGTATGTCTGTATGATGATCAATAATCCAGTTGAGCTAGCTAGCTGCTTCCTTCTCAAAAAAAAA
page-top