Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12481  (registered. 2012)
Contig Information
Length 1682 bp
Clones alternative view 79 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 3
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 1
WH_XN Leaves, plant was grown at constant 23 5
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 8
WH_XR Roots, 18 day old plants were grown hydroponically 5
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 8
WH_SP 3
WH_XE Seedling, infected with leaf rust 7
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 7
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 3
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125540839|gb|EAY87234.1|| hypothetical protein OsI_08636 [Oryza sativa Indica Group]
Score 711
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12481
GAACCTCTCATATCAAAACCCTAAGCAGGTCGGCGGCGGCGGCGCAAGCATCCCCTACTCACCCCAGGCCCAGCCTCTCCCCTCCCATCCTTCCCCAACA
TGCTCCCCCAGATGCGCCCCCTCCCTTCCCGCCCAGCCATCCACGCCGTCCACCGGCGCACCTCCCCCGCGCCGCCCTCTATCGGCGGACTTGGGCAGCA
TGGCCGAGTGGCCCTCGTGAGGACGACCAAGGCCGTGGTATGCCGCTCCGTCGCCAGCCCGGCAGCGAATCAGGGGGCGCCAGCGGTGGAGAGGCCTTGG
AAGCTTAGCGACGCTCGCCTCGTTCTCGAGGACGGCTCCGTGTGGAATGCTAAATCCTTCGGTGCTTCCGGGACTCAAGTAGGCGAGGTGGTTTTCAATA
CCTCATTGACAGGGTACCAGGAGATTTTGACTGATCCTAGCTACGCCGGTCAGTTTGTTTTGATGACCAACCCTCATATTGGGAACACCGGCGTTAACTC
TGGTGACGAAGAATCCATAAAATGCTTCCTTGGTGGCTTAATCATAAGGAACCTAAGTATATGTACTTCCAACTGGAGGTGCACAGAAACACTTGATGAA
TATTTGAGAAAGAGGAACATTATGGGCATATATGATGTGGACACACGTGCAATAACACGCAGGTTAAGAGAAGATGGCAGTCTCATTGGTGTTCTAAGTA
CCGACCAGTCTCTCAAAGACGAGGGATTGTTGGAAATGGCCAAAAATTGGAAAATTGTTGGTGTTGATTTGATAAGTGATGTTACATGTGATGCTCCATA
TGAATGGGTAGACAAGACCGGTTCAGGATGGGAGTTCAACGACAATCAGTCAAGTGAAACTTTTCATGTCGTTGTGTATGATTTTGGAGTGAAGCATAAC
ATTTTGAGACGCCTGGCATCATATGGATGCAAAATAACTGTTGTTCCAGCAAGCTGGCCTGCTTCGGATGTACTTAATTTGAAGCCTGATGGTGTTCTTT
TTAGTAATGGCCCTGGTGACCCAGCTGCAGTTCCATATGCCGTGAAAACAGTACAAGAAATAGTAGGGAAGGTTCCAGTATTTGGTATCTGCATGGGCCA
TCAATTGATCGGGCAGGCTCTTGGTGGAAAGACGTTTAAAATGAAATTTGGTCATCACGGAGGAAACCATCCAGTTCGTGACAACAGGACCGGACGTGTA
GACATCAGTGCACAGAACCATAACTATGCTGTGGACCCTAAATCGCTCCCGGAAGGAGTACAAGTAACACACATCAACCTAAATGACCAGAGCTGTGCTG
GTCTTGTGTTCCCCAAGATGAAGCTTATGTCTCTCCAGTACCATCCGGAGTCCTCCCCAGGGCCCCATGACTCAGACTTGGCGTTTGGTGAATTTGTGGA
GCTGATGAAGAACAACAGATTGTGAGTGGAAGAAAGGTTGGGAAGCTTGGTGAGCATCATGAGTTGCGAAACTTGTACTCGGTTGGGTTTGTTGTTGGAC
CGACGCAGCGAGCTCCGAGGAGTTTGTATTTTTCTTGTTGATTTATCTTATCAGCTGACCAAACCTATAAAGTAACTAGTGTATTGTACTATTTTGTTGG
AGTTTAAAGAATAAAATCCTTTGAGCTGTTGTAAAAAAAAAAGCTTATTCTATTTCTGTTTGTGACGTCGGTAAAAAAAAAA
page-top