Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1248  (registered. 2012)
Contig Information
Length 977 bp
Clones alternative view 24 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 5
Wh_r Root 5
Wh_DPA20 Seed DPA20 6
Wh_EM Dormant seed with water absorption 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_SHC Shoot grown with cold treatment 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|21263612|sp|Q9ZRI8.1|FDH_HORVU|FDH_HORVU RecName: Full=Formate dehydrogenase, mitochondrial; AltName:"
Score 567
Evalue 7.00E-160
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1248
GCAGACATCCATTATTTCCATTCTCAGAGAACACTCATACAACAACACAATGGTTTCTTCTCTCGCACCTCGCTTCAGATATGTTACCATGCAGCGCCGA
GGGTTGGGTTACTACTTGTACTGGCTGGCGAGCTCGCCTTCCTTGACGATGTAGTTCTCCGCGGGGAAGTCCTCGCCCTTGAAGTACCTATCCAACATGT
CCTTCACTCCAGCCGCGTACCTCAGCTGTGCATCAATTGTAGTCCCAGAGATGTGAGGGGTCATTGCATGATTAGGCATGTAGCGCCATGGGTGATCCTT
GGGTGCGGGTTGGGGGAACCAGACATCACCTCCATATCCAGCAATGTGACCGCTGGAGCAAGCATCAGCAACTGCCTGGGTATCCATGATTGCTCCCCGA
GCGTTATTCACAATGATTACACCTTTCTTCATCTTTGCAATCTTTTCTTTGTTGAACATGCCTCTAGTTTTCTCAGTAAGAGGTGTGTTTATCACAATGA
CATCACACTTTGGAAGCATAGCATCCAGGTCCTCTTCAAATTTCGCCCCAATTTCTTTCTCAAGCTCTGGGTTAATCTGAAGTCTGTCATGGTAGAGCAG
GTTGCAGTTGAAGGGCTTAAGGCGCTGAAGTAAGAGCCTGCCAATACGACCTGCCCCGACAGTTCCGACGGTCTTCCCCTCAAGATCATAAGCCCTATGG
GCAATGCCTGCAACATTCCATTCACCTTTAACGACCTGTTGGTAGCCAGGCAAGAAGTTCCTGAGCAGAATCAAGATGCGCATGAGCTCATCTTCTGCCA
CAGAGACAGTGTTACTTCCAGTGACCTCTGCCACTGTCAAGCCTGCAGCAGCAGCAGCTGGCAAATCAATATGGTCCGATCCAATCCCAGCAGTGAGAAG
CAGCTCAAGGTTCTTTGCCTTCTTGATCCTCTCTGCAGTAACATAGGCTGGGTGGAATGGGGTGGTTATCAGAACAT
page-top