Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12395  (registered. 2012)
Contig Information
Length 1855 bp
Clones alternative view 111 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 3
Wh_h Spike at heading date 5
Wh_SH - 5
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 6
Wh_KMP Shoot grown under continuous light 5
Wh_KMV Shoot grown with continuous light after cold treatment 7
Wh_PCDAM Anther at meiosis 4
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 6
Wh_VABA Shoot with ABA treatment 3
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 10
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 6
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 9
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XT Roots, 18 day old plants were grown hydroponically 9
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23Ž 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115472485|ref|NP_001059841.1|| Os07g0529600 [Oryza sativa (japonica cultivar-group)]
Score 526
Evalue 3.00E-147
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12395
AACTCCCGTGTCTGCTCAAAGGGAGTGAACGAACAATCAAACGCTGATACAAAATAGATACAACAGTGGCCAGCTATGCAAAGCTGGCTCGATGTACGTA
CTCCTATCTCTCACATGGAGATCATATCAGAGCATTTATTCATGTATATGTATATATGTGTGTGTGAGACCTCAACGTACTCAGCATCAATCGCTGGAAC
TATAATCGGCGATGATGGCGGCCAGAAATCGATCAGTGGATCTTAGAGCAGTCCACGGATGCGCTGATCGTGTAGGGGACGCTGACGCCGCACTTGGAGG
GAATGCCTGCGGCCTTGTTGGGGTTGAGCCCTCCGGGAACACTCTTGAGGCACCTGCATGTAGNTTGCTTGTCGGCGGTGCTCCGCGCTAAGCCGGCCAA
TTTCCTGACGCCGCTGCAGCAGGCCCCAGACGGGCTGGTCCCGCTGCCCTTCGCATAGGCGACNNNNNGGGCCAAGGCAGAGCTCACCTGGCCGCAGCTG
ATGGCCGCGTCGGAGGCTGCGAGGATCATTGCCGCCACCAGGGCGACCAGCACGAGCTTAGTAGCTGCAGTGCGAGCCATCTCGACCGAGTTAGCTGTAG
TTGTGGACCTTGTGGTGGTGGGCTAGCTCACGGAGAGAGGGTGGGATAGCTAGCGGCACGAGGCCTCGTGCCGAATTCTTTTTTTTTTAGAACTCAACCT
TTTTATTCCCTCCTCTTGTTCCATAAGGATTCATCATCCATGGAGCTGCCGTGAGGCAGAGCAGAGCAGAGCACATGGCGGGCAGGTGGCATGAACAAAA
TACGCTAACACAAGAAAACTAAAGATAAACATCGGAATTAAACACGAGTCTGACAAATCACAAAGACAAGACCTCGTCCCTAAGCATCCTCTGTTTCACC
GAACCATCTTATTGATTTTTCGCCCCGAAACACCAGCGTACGTACGCCTTGGTGTCCGTGGTTCATTGCTTTGCTTAGGCGTCCACGATGTCGCCGTTGT
TGGTCGCCGCCAGGATCATCTCCGGGTGCAGCGCCGGGGTCACGTTCTTGAGCGTCCCGTCGATGCCGTTCGGCCGGCCGAGGGCCTTGAGCGCCAGGTG
CGCCGCCTTCTGGCCGGAGATCATCATGGCGCCGAAGGTCGGGCCCATTCTCGGGGCGCCGTCGATCTCGGCGACCTCCATGCCGGTGACAATCATGCCG
GGGACCACCTCCCGGGTGAGGCGCACGATGGCATCCTCGGCCGTGTTCATGTCGAGCGCCTTCATCCCGGGCACCGCCTGGATCATGCCGATGTCCTGGA
GCCGCTTGACCCCGGTGGCGCCGAAGGGCCCGTCGTGGCCGCAAGAGCTCACCACGACCTTGGCCTCCATGACGTTGGGGTCCATGCAGGACTGTGTGTC
GTGGTTCATGGAGACGAGCGCCCAGTTGGTGACGACGCCGGCGACGCGGTCCTCCTTGACGATGAGGTCCTCCACGGCGACGGCGTTGAAGAGCTTGACG
TTGGGGCGCGCGAGGAGGCGGCTCATGACCGTGGAGGTGAAGAGCGCGGCGTGCTTGATGACGACGTAGTCCTCCTGCTCGTCGTACTCGATGTTGAGCT
CGTCGAGGAAGAGGTGCGCCGGCTTGCGCACGACCATGGCGGAGAAGAGCTGGCCGCCGAGCCAGGCGCCGCCGCCGGGGGACACGGACTGCTCGATGAT
GGCGATGCTGATGGAGGGGTCCTTGGAGAGCTCGTACGCGCAGGAAAGCCCCGCGGATCCGGCGCCGACGATGACGACGTCGGTGTCGGCGTAGGTGATC
ATGTCGGTCATGTAGCGGCGGGTCATCTCGCGGGACACGATGGACTCCTTGATGG
page-top