Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1239  (registered. 2012)
Contig Information
Length 828 bp
Clones alternative view 26 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_EM Dormant seed with water absorption 5
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_SHDr Shoot grown with dessication 4
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 1
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XA Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226530464|ref|NP_001150743.1|| gda-1 [Zea mays]
Score 253
Evalue 2.00E-65
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1239
AGCGGTACAGAAACAGCAGCATAAGTCAAATGCAAGGTTCCAACTTTCCAAACCAAGGTAAGGTACAGAGACAACAGATACACTCCCAGCATCAACCGCC
CTCACTTTGGGGCATTCATGATGCATCACAACAGTATCCCCCGTCTTTCGGGGTTTCCCCGCTGGCGGCGGGCATACTGCACTACAAGTACATAAATATG
AAGAACATACGCATCACCGAGATTACGGACAGACGGCACCGACACAGACAGGCTCACATCTTTAGAGGCCTACTTCTTCCAAGCACCAGGTCCTTTCTGG
GGGAAATGCACCACCAACCAACAGCTTGCGCTTTCATAGACGACGGACGGAACAGATCATTGTGAAAACATCTTCCACAACTTACAGGGATGATATTTAC
TAAAAAGAACCACAGAGCAACCACAACCATGTTCCAAAGCAGATCAGGCGTCTTCCGTCTTGCACAGGTCCAGCAGTGACAGTGTCTCTGCTATGGAGAG
CTCGAGGCGGAATTTAGGACCATCATAGTGGTGCAGCACTGGCCTAAAAGCATCCTCTTCCAAGGCCTTGCAAAGCCTTCTAATGCGGATCCTCACCTGT
GCTGGGAATCTGGATTCACCTTTGCACTTCTTATCTTCCCAAGCGGTGGGATCAATGTTTGATCCTCCAAAACTAGCAGCCTCAAACACCCCATGTAGCT
GATGGGTCGTGTAGTTGTAGAGGAAAAGAGGTAGACCAGGAGTGATGGCTCGGACTGAATCACGATATCTTGCTGGCAAGCCAAAAAGCTGTCTCTTGAG
ATCCTCCTGCATGGTATCATTGTTGCAG
page-top