Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12383  (registered. 2012)
Contig Information
Length 866 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|224159219|ref|XP_002338056.1|| predicted protein [Populus trichocarpa]
Score 175
Evalue 7.00E-42
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12383
AAGGGCGCGACGGTGGTGGCGGACGATGCCATCACGGCTGGGGCCATGGCACGTGAATTGCTAGGTGGGGAGGCGCCTCGTGCCGAATTCGGCACGAGGC
AGGGCTTGACATGCCGCGAATCCTCTTGAAAGAGAGGGGTGCCCTCGGGAACGCGGACACAGGTGGTGCATGGCTGTCGTCAGCTCGTGCCGTAAGGTGT
TGGGTTAAGTCTCGCAACGAGCGCAACCCTCGTGTTTAGTTGCCACTATGAGTTTGGAACCCTGAACAGACCGCCGGTGTTAAGCCGGAGGAAGGAGAGG
ATGAGGCCAAGTCATCATGCCCCTTATGCCCTGGGCGACACACGTGCTACAATGGGCGGGACAAAGGGTCGCGATCTCGCGAGGGTGAGCTAACTCCAAA
AACCCGTCCTCAGTTCGGATTGCAGGCTGCAACTCGCCTGCATGAAGCAGGAATCGCTAGTAATCGCCGGTCAGCCATACGGCGGTGAATCCGTTCCCGG
GCCTTGTACACACCGCCCGTCACACTATAGGAGCTGGCCATGTTTGAAGTCATTACCCTTAACCCGCTTTCGCAAGACTCTTTCTTTCTCCCCTTTCCCC
TCCCCCCAACCCGTCCGTCGTCGCCTCCGCCCGAGGTAACCGCCATAGCCGCGAGGAATCAAGAACCTTGCCTGCCGCACGTCGTCCCTGAGGACCGAGA
GGAGACGATGGAGGGCGGCTGCGGCGTGGCCGGCGGGACGGAGGGCGGCGGCGGCAAGAAGCAGCAGCAGCAGGCGCGGCCGCAGTTCGGGCGGTCGCTG
ACGTACCACCACCACCAGGGGCACCGGCTGCTGCCCCGGTGGCGGCGGCCGCAGCTGGCGGACGAG
page-top