Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12377  (registered. 2012)
Contig Information
Length 2448 bp
Clones alternative view 29 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_r Root 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_PCDAM Anther at meiosis 2
Wh_SHDr Shoot grown with dessication 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XB Root 4
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125558336|gb|EAZ03872.1|| hypothetical protein OsI_26008 [Oryza sativa Indica Group]
Score 1199
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12377
CAAAATTATCAACTCGACTTATTTTGCTCTCTCACATGGTACAACAATAGATATTATTACCCAATGCCATTGTACAACAGTATTACATAGTAAATAGATA
CAAAGAACTGTGACATAACATTGGTAGCTCATGTCCAAGGACCTTTACAGCAATGAGTCTGTCTTTGCAGGTAGCCTCCTGAAGAAGTTTACTGGCGCTG
CGGGCACCTTGTGGCGAAACCGTGGGTGCCTCATCCAGAAGAACCCAAGGCAGAGCGCAATCACTTGAAATGGTGTAATATACAGTATAATTGCAGTGAA
CAGGCAAAATAATAAGAACATAGCTGTTGCTCTTGGGTCCCTCCAGCTCAGCAGTGACTGCAATCTCTCACCCTGAGTTGCGATGTCGCCAACAACTGTC
TGTATCCTGCCTGCAACGTGTCGTAGCCTGTCATACCTCATCCTAATCAGGTCAGCGCTCTTCGAGGTTGGGAACGTGTCAAATTCCTCATCAAGCTCGT
CTGGATGCGCAACATCCGCATAAGATATCCTTGTGTTCATATGTGGTGGGACACGTGGCCGGAACCGATAATTCCACAACCCAATCAAGAACATGTAGAG
GAAGATCGTCGGAAGGATAAGGTCTGGATAGAAGACGAGCATGATGAAGAGTACATGGACCAAGACTGTGGTGACTGGGTTTTTCCACTGGCAAACGTCA
CCAAACCACTTCCCTGCAGCAATGAATCCAGAGAAGACTTGCATCAGACGGAAGAAGTTTGCTTTGCTTCGTCGCATGCTCCACAGGTGAGAGCGTGCGT
CTGACATGAACTCAACAACTTCCCTGCGAACTGGTGGTTCCATGCGCCCCAGGCGCTGTGCAACAAGCTGCACAGCCTGGTGGCGTAGCATTTCCTGCTG
GACTATTGACAGTGGCTGGGCGTAGTGCATCTTGGGCAAGAGAGGACGTGAGTATGTAAGGAACACATTGAGCAGGGATGTGACTGAGAACCTGATAGCA
AGGTGGATTTCACCCATCTTTTTAACACCTGATGGGTGGAGGACAAGCAGTGGATATGTGTGCGTGTACACCCGCCTAGTCTCAAGGGTTGAGATCCTGA
TTCGGACTTTCCCAATGGGTTTATCCATATGACTGGGGGAACTGCTGCTGTGGCTATGACTCTGGTTGTGGCTGTGGCTGTGATTGTTGTTGTCTCCCCC
TATGTGGCAGTTGTCAAATAGACCAATGGTGAGTACTGTTCCATGGTCAAAGACATCCCATGTATACTGCTCATTGAACCGAGGGTTCAAGTTGTCAACA
ATTGTGCGTGTCCGCACCCATTTATGACCATACTTGGCAACACAATATGGATCACATGACCCCCTTTCTTGCCTGGTCTTTGTTGGGTTGAGGCCATTTG
CACTTAGAATCCCAACTTCAAGCAACCCAATTGGTGGCTTCCACAACTGCTTCATTGTTGGCCGGAGATCGCTACAATACTGTGTTGACTCATCAAGCAC
ATGATAACCACCTTCAAGGCAAATACGAAGGTTCACCTTTGCGTAGAATTTGTCTTCCTTTAGCTGGTTCACATCAATCAGTCCTGGCCTTCTGAGATCG
AACCACAATGGACGTACTACTGCCTTGTGGTCAGCCCTCTTTTGAATCCTTGCGAGAGGTATCATAGTTTCACCAATCACCTCATCTTTGTTCTGTGCAA
CACGATTTTCTATTTGTATGATCAAGTCATCCTCAAAAGGCTCTGCTGCGACAAACATCATTTCTTCATTCCACATGAAGTTCTTGGTTGGTGAGCGAAC
TTGCCTTGTCTTCAGTAGTTGGTGACCCAGCCTCACCTTTACAAACACATCAGGTATGTGGTGGTGTTCCATTGTGAATATATCCTGTGCCTCAATTACA
TTGACCCTGACGTACCACATTCTCGGTGTAGGGTAGACCTTTCCACGGATATAGTTGTGAAGATGGGAATCTATTGGTGTTGTTCCTGCATGAATGGCAC
TTGGGAAGCATTCATCTGCTTGGGTTCCGTACCAGACTGCAAGCATCAACTCCCCTCTGTCCCTCATCCCATCCTTGCCCATAAGGCGATCCGGCAAAAA
TGCGATGTCTTTATCAGCTAACCAGTCGGTATCCGGCGTGCCTGCAGGTTGCGTGCTGAAGGTCATGTCTTCCTGACCTTTTAACACAATCTGAATGTCG
AGATAGCGGGCATGGTACTCCGCACGCCAACCATTTCTGACGAAGTGAAACAGGAGATGCTGGCAGTCATTGCTATCGTGAGTGGAATGTGTTTTTACGC
CAGCGTACTCATGGCGACGACTCCGGCGGTTGAGCTGGAATTGCAAATTCTTAATGCCATCTTCCTTGGTATTCTCTGTGGTATCGGCATGCTTTATTTT
CAGGACTTGATGCCTGAAAAAATAGGCTCTGCGACAACGTTATATGCA
page-top