Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12368  (registered. 2012)
Contig Information
Length 1457 bp
Clones alternative view 39 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_oh Pistil at heading date 2
Wh_r Root 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 3
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VSCB Liquid cultured tissue 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
WH_SP 2
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XV Leaves, plant was grown at constant 23 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|126517972|gb|ABO16371.1|| serine/threonine-protein phosphatase PP2A-1 catalytic subunit
Score 659
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12368
TTTTTTTTTTACTGAAATATGATTTAATTAACTGAANNNTGCCGTCGATAATACAGATTACAAGCCTAGTGATACAAGCTTAAGCTACATATAGGAGTTC
AGTCTTTGCCAATGTAAAATGCCATGATTCTATGAAATTGCCAAAGTGTGGAGGGATGGCCCTTTCTTCACCTGGAACTCAGGGCAGGTGGCTGCATGAA
GCTTCTTTTGTTTCAGGATGGCAGCAGTCTTTTGGATTGACCAATGGGGGTCAATTTTACACAGGGCTCTGGTACACCCCTTTGTTATTGTTTGTTGGCT
CATGTGCAGATTTGGATCCAGCAGAATCTCACTGATCGGTGCGGACTATCGCAATACAAGCTGAGAAATGGTGCAGCCAGTTTACTCAAAGGAAATAATC
AGGTGTTCTCCTTGTCACGTCTGGCTCACCTCTCCGAGGGGCTGGCTCAAACTGGATAAAGGTGTGAGCATTGCAGTCATCAACTTCCAAAATGGACGCC
ATGTTGCCACATCGGTAACAATAGTTTGGAGCACTGAATATGGTAACAACTTTTTGTTCATGAGCCCAGTTATATCCCTCCATGACTAACTGATGAGCCC
GGGCTACAAGTTTGAGATTGTTGGTGTGATTGAACTGCTCAGATATGTCCTGCCCAAAAGTGTAGCCAGCACCACGAGGAGAAATGCCCCAACCACATCG
ATCGTCCGGATCAGACCATAAAAGATCACACATAGGTCCCTCATGTGGAACCTCTTGGACACGATCCAAGCTACGCACACTATCAAGATTCTCAATCGAT
GGAGATAAACCACCATGCAGGCAGAAAATTTCAGATTCCACCAGGGCTGTTAATGGGAAATAATCAAAAAGATCTGTGAATATCTTCCATACATTTGCAT
TGCCGTACTTCCGTAGGCATTCATCGTAGAATCCATATACTTGTGTGATCTGCCGACTCTCATGGTTTCCGCGGAGGATTGTAATCCGATGTGGGTGGCG
AACCTTCAGTGCTACCAAGAGAGAAACAGTCTCAACGGAGTAGTATCCACGATCCACATAATCCCCCATAAACAAATAATTAGTATCTGGGCACTTCCCG
CCAATCCGGAAAAGCTCAACAAGATCATGGAATTGTCCGTGAATATCACCGCAGATTGTCACTGGGCTTTTGACTGGCTGCACATTGCTTTCCTCCATCA
ATATCTCCTTAGCCTTCTCGCATAGTGCTTTAACCTCTTGCTCGGCAAGCGGGCGGCACTGCAAGAGCTGCTCGATCTGCGCGTCCAGGCCGCCGCAGCC
GCTGCTGTCCACGCTCATGGGCTCCATGTCCTCTCACGCCCGCCTCCTCCTCCGCCGACCGTGGGAAAAGGCAGCCTGAGCTGGAGCTCGTCGCCGGCGG
CTAGGCGGGGCGAGAGGGGGGAGGGGAGCGCTGGGTCGGGGCCGCGGAACAGGAGAG
page-top