Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12341  (registered. 2012)
Contig Information
Length 941 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_r Root 3
Wh_yd Spikelet at late flowering 1
Wh_PCDAM Anther at meiosis 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218197335|gb|EEC79762.1|| hypothetical protein OsI_21153 [Oryza sativa Indica Group]
Score 361
Evalue 8.00E-98
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12341
CCACCGGCTGGCACATTACGTTGCTTGCACATACACATCCCAAACAACGTCAGATAACATCTCTGGTCACATATTACAACACAAGGAAGGGGTGGACATA
ACAGCATGGAGGAGTTAACAGAGTTCTACACGGCAAATTACATTCTAGGACAGATCCAATGAAATCATCGATCGCAGCCAGTCCACAAACTCTGCCTAAA
ACACGACTACAGTTAAAAAGACCACTCACAGGCGCCAGAAGACATATATGCATGCTTCAGCAAAGGAAGCGAGCCTAGTCCATCTTGAGAAGCCCAGAGC
CCGGCGCCGCCTCCGGCGCGGCGGTCGAATTCAGAAGCCAGTCCTTCGCACAGACGAGCGCTTCCACGATCTCCGGACGGAGCGAGCTTCTGTAGTCGTC
GAGCACGTGGCACCCTGTTCCTGCGGAAAATATAGAGGTTCCGCCGGTCACCATGGACACCGGGATGGCCAAGATGTCCCGCGCCATCTTTGAGAGCGTC
GGATACTTCTGCATGTTGAGCTTCCACCAGTTGAGAATGTCAAACTCTTGGATGCGAGGAGTGAGAGACTCGTCCAGGTACTGCTCTAGCTCAGATTTTG
AGGGCTGGGTTGTGGCAATCTCGGAAAGATATATATCAAAGTCTTGAAGGCCATCACCAGCTGAAGGTTGAGTTGCTTGGGTGTTGTTCCCATTGGCAGT
AGCATTATCAGTTTTCCCTTGTTCAGCATAGGTCGGTGTTAAGGGGAGCGGCTGTGCGACATAATCCTTGAAAAGGTCATGCACCGAATCATTTACCACC
TTAACATACTTCGCAGCCTCAACGCCGTAAATCTTTGAGTAACTGAACTCAACAAGCTTCATCTTAAAACGTGGATCCATCACAACAGCAACAGCTAACA
CAAGGTTGCAATCTTTCCAGTATTTGTCAAACCTCTCATAC
page-top