Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1233  (registered. 2012)
Contig Information
Length 1512 bp
Clones alternative view 28 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 1
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_PCDAM Anther at meiosis 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VSCB Liquid cultured tissue 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_F/WH_R 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125537496|gb|EAY83984.1|| hypothetical protein OsI_39210 [Oryza sativa Indica Group]
Score 787
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1233
TAAAAAATCTCCAGGAAGTACTCTTTATAGAGGGATCAAGTAATACAACACGGTAGCAATTCTTACAAACCAGTTTCCACAAATTCTAAACTCAGAAAAC
AAAAGGGTGCAATGTAACCGCATTATTTGTCTGATTCTGATGTGCCATTTGATCCATAATAACGAACACAGGTCACCCAAGACGGTAAAACACTAATCGC
TGCAGGCGACAGGTACAGACAGGAGCCGCAGCCCCAATCAGTAGTCGTCGCCTCTGGATATGACTTCTTTACAGGTTGGCCGGAGCAAAATGGTGTGCTC
AAACTGGGACACATAGCTTCCCCTCACATCGCACAATGGCGGGTACGGCTGAACAATGCCAACATCACATAGATTTTTCAGTGCCATGAGATACTTGGTC
TCGCCGATGCGGTCCAAGTACCGGCGGCAAAATGCAAGTGTTCCAAAGTTGTTGTTGATTGTCCCCAGTAGCTGCTTGGCTTTTGCTACCCTCAACGGTA
CATGCCCAACATCAAAGTTCTTCATGTAATGACTGCATTCCAAGTCCTCCCTCACAAATCCCTTTCCTGTAGACCCAAAAGTTTCAATGGCATAAAATTC
ACCCTCCTCCATTTTAGTTTGCTCTCCGCCTTTTACAATTGGGACTGATTTACCAGCATGGATTTGGTATGGTCCAATGCTGTGTCCATTGAGGTTTCGC
ACACTTTTTACTTGGAAAACTTTCCCATTAATTTCAACCTCATATGACTCCATGACTTCTTGGATTGCAGCACCGACATCACAAAGCCGTGCATCTATTC
CAGCTTCCTTGATTCCAGTATTTGTGGCATCTCTCGTTGCTTGCAGCAACGGATCAAACATGGGATTAAATGCGACGGTAAATGCACAATCAACTATGTG
CCCATCGATATGTGTCCCAAAATCCAGCTTCATCACATCATCATATTGTAGTACAGTTTTATCACCAGAATTTGGAGTCCAGTGAGCTGCGACCCAATTC
AACGAGCATCCTGTTGGAAAGGCAATGCCAGCTTGCAGTCCATTCTCCTTGATAAGTTTCCGAACCATGTTTTCCAAAGTCTCGCATAGTTCCATCATTA
GCATTCCAGGCTTTATAATGCTCCTCATGTACTTTCGTACCTGTCGATGGACTTCTGCAGCTCGGCGAACAGAATTGTACATTGGTTTTTGTAGTCGTTC
CTGTTCCCTCTTTTCTTCACTAGTTGTTCTCCATAAATTATCATCCTTGTATTCCTGGATTTCTCCCTCAGGAAAATCTCCTGAAGGGAAAAGCTCATCC
ACAGGGATTGATGGAGGATCTGTCTGCTGAAGGGGGTCCTTCTTCTTTTTGGCCTTGCTTTTCTTCTTTTTCTTCTTCGCAGCCGCTGAAGCTCCTGCTC
CACCTTCAGATGGACCATCCACTTGTGCGTCATCATCATCTGCTGGTGGTGGTGGGGACTGAGCTTCGGGAGCCCCGCCATTGCTATCTGACGCCTTTTT
CAGAATCTCATC
page-top