Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12271  (registered. 2012)
Contig Information
Length 830 bp
Clones alternative view 22 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_VSCB Liquid cultured tissue 4
WH_XF Seedling, infected with leaf rust 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115443807|ref|NP_001045683.1|| Os02g0116900 [Oryza sativa (japonica cultivar-group)]
Score 228
Evalue 5.00E-58
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12271
TTTTTTTTTTCCAGCAAGATGATATCAACAAATGTTTAATCAACTCCGTCTTATAGTCATAGCATATAGGAGGGTAAACTCCATATATCTCCAACAAGAA
GCTACTACATTTTTCTCCAAGACAGCATAACAACAAGGTTTAATCAACTCCATACATTTGAGATTGACACTGCTGATGCCTTATGATCATAGCATAGGAG
GAGATAATCTGAAGATTAAACATATCACCAAACTAGGCTACTAGTAGCTAGTACTTCTTGAGACTGATAAATGGCACACGGTCTCCATGTCCATGTCCAC
TGGAGGAACACAAGAAGAGCAAGAAGGAGCATATTATGGGGGCGGCTACTCGAACTTCTTGATGAGTGAGAGGTCGTTGAGCATCTTGTCGACGCGGTCG
TCGCTGTCGAACCTGCCGCCGGGGACGAGGGAGGGGACGAGCGCCTTGGCCTCGTCGGCGGTGTCGGGGCAGAGGTTGCCGAGGGTGCAGAGCTCGAACT
CGACGAGGCTGTAGCGGGAGAGCGTCTCGCGGACCTGGCGGACGGCGTCGGGGTTCTTGTAGCGGCTGAAGCGCTTGACGTAGGCCTGCGACTTCTCGAA
CACCTGCGAGACCTGGTCGGCGCCGCCGTCCGACATGTGCTGCAGCTGCTCCCACTTGTGCTCCAGGATTATCGCCACCTCGCAGTTCATCAGGCACTTG
GCCTTGAGAAACTCTTCGCCGATCTTGAGCTCGGCGGCGTTCTCCTCCTCCTCCACGCCGGACATGGCGGCTGGCGCTCGATTTGTTCTTCTCCGGCGGC
TGCTGCGGCGATTCGGTTCGGCGTCGGGGA
page-top