Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12266  (registered. 2012)
Contig Information
Length 1206 bp
Clones alternative view 205 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 4
Wh_oh Pistil at heading date 9
Wh_r Root 4
Wh_yd Spikelet at late flowering 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 16
Wh_SHC Shoot grown with cold treatment 6
Wh_SHDr Shoot grown with dessication 30
Wh_V4816 Shoot grown under cold condition for 16days 5
Wh_V483 Shoot grown under cold condition for 3days 9
Wh_VHS Shoot with heat shock treatment 4
Wh_VWD Shoot grown with dessication 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23 6
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 7
WH_XT Roots, 18 day old plants were grown hydroponically 16
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XA Root 5
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XD Root, treated at 50 microM Al for 6h 9
WH_XE Seedling, infected with leaf rust 12
WH_XF Seedling, infected with leaf rust 13
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1169018|sp|P46524.1|CO410_WHEAT|CO410_WHEAT RecName: Full=Dehydrin COR410; AltName: Full=Cold-induced COR410
Score 522
Evalue 4.00E-146
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12266
TTTTTTTTTTAAACACGCAACAATATACGCTATATATCTTCACAAAATTTTTTTTTTTTTACTGGGCGGAAATCTTTAATATCAAGGCATAATGCCCAGC
AATAAACCAATACACAAGTGCCCATAAGTAAACAAACTTGACAACATCCAGGACCTGACTCTGAACCAAACTGAAACAGAAGCACCCGTCACTGAACGGG
CTTCACGGACCGGACCTTCAAAGACGATCAACCCCTCCCACCTTGACACCAACTTAGACGTAAAGCAAACACAACACACGCCAACAATTCAATCGAGGTC
CGGTCACGGGTCTCGGGCACGGCGGCGATCAAGCGCTGGGCTTGTGCTCGCCTGTAGCGGCGGCGGCCTTGTCCTCCTCCCCTGTCTTGTGGTAACCAGG
CAGCTTGTCCATGATCTTGCCCAGCAGGCCCTTCTTCTCCTTCGCGTCAGGGCTGCTCACCTCCTCGGGGGCCGGCGCCGGCGCGTGCACTGGTGCTGGA
GCAGCGTGCGTGACGGGCACCGCAGCAGCGTCCTCCGGCTTCTTGTGGCCGCCGGGCAGCTTCTCCTTGATCTTTTCCAAGAAGCCTTTCTTCTCCTCCT
CGGGCACTGCCGGTGCCGCCTCTGTCTTCACGTCGCCGTCGATCTTCTCGACGACGACGTCGGTGTCATGGTGGCCGCCGTGGGTCTGCACAGACGCGGG
GGCCGCCGGTGCCGGTAGCCCCGTCACGTGCTCACCCTCGGTGTCCTTGTGGCCGGGCAGCTTCCCCTGGAGCTTTTCCTTGAGCCCCTTCTTCTTCTTC
CTCTTGATCACCTCGCCGTTGTCATCGATCACCTCCTCTTCTTCCTCGTCACTAGACGAGCTGGAGCTGGAGCTGGATCGGTGCAGCTTGGAGAAGAGGG
TCTCCTTCTTCTCGCCATCCTCGTGCTCCTCCTTCTTGACCTCGGGCTCTTCCACGGAGACCTTCTCCATGCCGGTGACCAGCTCCTCCTCCTTCTCCTT
GTCCTCCTCAGCCTTCTTCTTGCCGAGGAGGTTGCCGAGGAGGCCCCTGTCCGTCACCTCCACCTGCTCGGCGGCCTCACCTCCCTGGTACGACTGGGTG
CTCCTCTCATCCTCCATGATCGAGATCGATCGGTGCAGCTAAAAGTCTTCCGGGAGCTAAAGGAAACAACAGATCAAGTATTGGTTCTTGGCTTGTGGCT
TTTGCT
page-top