Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12260  (registered. 2012)
Contig Information
Length 655 bp
Clones alternative view 43 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_SH - 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 1
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 6
WH_XR Roots, 18 day old plants were grown hydroponically 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 4
WH_XB Root 9
WH_XF Seedling, infected with leaf rust 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|14585847|gb|AAK67625.1|| hypothetical protein CX157 [Homo sapiens]
Score 240
Evalue 1.00E-61
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12260
GTCATGCATAACTTACTTGACATTTTTTTTTTAGTAAATGTAAACGATGAACTAGCTGATGAGCACAAAATAGTTGCCATACAACATCCATGATAAAAGA
AACACATGGAAGGAGGCGAGTAATTTTATTTTGTTCTTAACAATCATACAGCAGCTCAGTTGCATGCTATCATCTGGAAAAGTGAAAGTAAGTCCTTTGC
ACTCCGCAGGTGCCAGGCTCTGCTCACAAATGCATGATTCTTGTTCATTGGTCTTCTTTGCCATAGTTGTAGATAATCTCAATCCCTTCAGGTGGAGGAG
GGTTCCTTGTGAATTTAGTGCCACCAGGAGCCCATGGAACAATGTAAGGATCCGGGTGCTGGAAGTTCCTCTGCTGCGCCTCCGCGTCCTCGATGAGCCT
ATCGATCACGTCCAGGTTCTCCACATTTCTGTTGGCCTCGAACTTGTCCCTGAGCTCGGACGCGTCCTGGTAGAAGAGATGGCGGTGGACGGCCCAGTTG
AGGGTGTCCTTGAGCGCGCGGCGGTAGAGGAGCCGCACCCGCTCCTTCTGCCCCGCGCGCCGCGCCAGGTACCCCGCCGTCGTCGACATCGACCTCGCCG
CCGCACCCGCTCCTGCTTCTTCTCCGGAGATTCTCTCGCCACTCCTCTGCGTTGG
page-top