Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12252  (registered. 2012)
Contig Information
Length 1925 bp
Clones alternative view 36 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 5
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 5
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_VSCB Liquid cultured tissue 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|117646987|dbj|BAF36565.1|| Shaggy-like kinase [Triticum aestivum]
Score 833
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12252
TTTTTTTTTTGCACGTTGCAACAAACGACTCAATAGGAGCCAACGACCAAGTACATAGTACTGCAGTAGCAACAGGTAGACTTCAACAACAGGAATCTAG
AACAAGGTGGCACGAGTCTTGACGATCAAGAAACTAGGAAAATCGAGAGGACCCATACAAGGATCACAACTACCATAAATACATTCATACTTCTCTAGAA
CATATTACAGATCAGCCATGGCAATCTGAATTCTCAGGCGAGGGTTAGTACAAGGGAGGGTGAACCGGTTACATTGTCAAGCTTGCATCGCAGCACACAA
CTACTACTCAGCTACACAGGTCAACAGGGTGGAGTGGTCATACATCAGGTCTTCCAACAACCATAATAGTTCATCACGCTCACATGCTGCCCAACCAACA
TCCCCAGGGGAAATGCGCACTTGTCGATGCAATTCCAACGACTCATGAGACAAGCATCTCATAGTCACGCATGGGAGCCCTGCTTTCTCGCATGCTCTGG
GATCAATTTCGCCGCAACATCCGCTGGGATTCCTTTCAGTTCGTTAGGCTTGAAGTTGAAAAGAGGAGGCAGAAAGCGGCCATTCGGAAGGCGGGTACCC
GGGTCCCGAAGCTCATCAAAGAAGGGGTGAACAAGTGCCTCCACAGCAGTGCATCTTAGGTTGGGCGAGTACTGGAGGAGCCGAGAGACTAGATCGACAG
CTTCAGGTGGCATCCTTTTATGGAATACCTTGTGCCATGGGTGTGCTTTAATCTGTGGGAATTTGAACTCCGTATAATTGGGGTTCATGCATTTAATTTC
TTCCCTTGTAGGGGTACCAAGGACCTTGATGATTTCAACAAGCTGGTCCACACCACTTTCACCAGGAAACAGAGGCTGCCCTAGCATAAGCTCAGCAAGA
ACACATCCAGCGGACCAAATGTCAATGGCTGTAGTGTACTCAGTAGCACCAAATATGAGCTCTGGAGCCCTATAGTATCGGGAGCAAATGTATGATATGT
TCGGTTCTCCCTTAACAAGAACTTTTGCACTCCCAAAGTCACACAGTTTCAGCTGGTGGGTATGTGGGTTTACCAGAAGATTTTGTGGCTTGATATCCCT
GTGGCAAACTCCAATGCTGCCATGAATGTAAGCCAGAGCCCTACATATCTGGTATGTATACAGCTTCACATAGATTAGTGGCATGCGCTGGTTCATCTTG
TTGTAATGCTTGACAACACGATGGACAGTCTCAGGCACATACTCAAGAACCAAGTTTAGATACAGTTCATCCTTCTCAGTTGTAGAAAAGAAACAATGCT
TCAGAGCTACAACATTTGGGTGGTCAAGCAGGCGCATGGTCTGTAGCTCACGGTTCTTGTAGCGCTTATCCTGAAGGACCTTCTTAATGGCAACAGTTTC
CCCTGTCTCCAAACATTTAGCCTGGAATACAATACCAAATGAACCTTGACCAACAATCCGCTCAGCCATGTAGCTCACGGTCTGTTTCGGCTGCCCATTT
TTGCCACCAGTAGTTGTGACAATTATGTGTCCAGTCTCTGTTCCCTTGCCATTAATAATAGTAGCTTCCACTTCCTTATCATCTCTTATCTTCAAATCGT
TCATCTGATCTGGTAGCTTCTCAGCACCCATGCTGGTGCCGCTGCTGTTCTTGTGCCCAGAGGGAGCAACGCCTACTGAAGCCATCTGTTACGGAAACCA
AGAGACGCCGATTCAGCAGCGCATCAAATCACAGAAGCAGTAGGTGTTTTGGTGTATCTCCTCCTCGCAGAGAGATCGCTGGATTCTCCCCTGCCCCGCT
CGCTCCGCCGTGTGTTGCAGCTGGGTTGGCTTCCCCCTTTCCTCTCCCCTCTCTCCTCTCCTTTCTGGTTGTCGGGACGCAACGAGATAGCAGGAGTAGT
AGTAGTACTCCAGCACCACCGGCGC
page-top