Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12231  (registered. 2012)
Contig Information
Length 1117 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
WH_XF Seedling, infected with leaf rust 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|221327786|gb|ACM17602.1|| LRR/receptor-like kinase [Oryza sativa Indica Group]
Score 446
Evalue 2.00E-123
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12231
TTTGCTCATAATCATACTCCCGGGTGCCACTATAGCTCTTGGTGCTACTGCTTTTTGCTTCTACTCTTGGTGCCTATCAATCGGAAAGAAACTTGAGAAA
GGCAAGGTCGAAGCTTCTATTGATCTGGAAGACCCGGTAAGCCATCAGTTAATCTCTCATGTAGATCTTGTCCGCGCCACAGATAATTTTAGTGAGGATC
ACATGTTGGGATCTGGGGGCTTTGGAAAAGTTTTTAAAGGCCAACTGAGCAGCGGTTTGGTGGTTGCAATAAAGGTTCTTGATATGCGGTCCAAGCACAG
CGTCAAGAGCTTTGACGCAGAATGTCGTGTGTTCCGCATGGCGCGTCACCGCAACCTAATACGGGTAATTAACACATGCTCTAACATGGACTTCATAGCA
CTAGTGTTGCAGTACATGCCCAACGGCAGCTTAGACATGCTACTTCACCACTCAGAAGATGGGGGAAGACAATTCGGGTTTCATGAAAGGTTAGCCGCTC
TGCTCGACGTATCAATGGCAATGGAGTATTTGCACCATGGATACCATGAAGTGGTTTTGCATTGCGACTTGAAGCCTAGCAATGTATTGTTTGATGAGGA
CATGACTGCACATGTGGCAGACTTTGGCATTGCAAGGTTACTACAATGTGAGGATAGCTCAACGATCTCTTCAAACATGCCGGGTACAATTGGATACATG
TCACCAGAGTATGGATCATATGGAAAAGCATCACGACTGAGTGATGTGTTTAGCTACGGAATAATGCTCCTTGAAGTTTTTACTGGAAGGAAGCCTACAG
ATGCTATGTTCGTCGGAGAATTAAGCCTCAGGCGATGGGTTTACCAGTCATTTCCTGCAAAGCTGAGCCATGTCGTTGATGCCCGGCTACTGCAAGGCTC
CTCTTCAAGTTGCAACTTGCATGGCGACTTTCTTCTGCCGGTATTGGAAGTTGGTTTGCTCTGCTCCAACGACTCACCTTGCGATAGGATAAAGATGAGC
GATGTGGTCGTTATGCTAAAAAGGATTCAAATGAAGTACACTGCATGGACAACGGAGACATCACAGAGTGCAACATCATGATTGATCACTCTTGCTTCGA
TATATTAATGTATATCC
page-top