Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12165  (registered. 2012)
Contig Information
Length 1344 bp
Clones alternative view 52 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 4
Wh_VWD Shoot grown with dessication 7
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 6
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 7
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 6
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125536565|gb|EAY83053.1|| hypothetical protein OsI_38270 [Oryza sativa Indica Group]
Score 398
Evalue 1.00E-108
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12165
AACAGCTCACTCACGACAGGCCATATATAAAGTGCCATTGCAGTTTTGTCAACTCTGACATTGCTTTGGGTTTTCCGAGAGCTCTCCTCTTCAGACCTCT
CCCTTCTCCCCACCAGGAGTCTAGGGTTAGAGAGAAAGAGTGAGAGAAGAGCAAAAACAACCTCTAGCCCCACTGTTGATTTAATTTGCCAGCAGGCTTG
TTGTCAACTTCATATCTATCCCATTTCCCTTCAATATCTTCATATCACAATGGGTGGCCTATCCATGGAGCACCCTTGGGCATTCGCCTTCGGCCTACTA
GGCAACGTGATCTCTTTCTCGAGCCTCCTGGCCCCGATACCAACATTCTACCGGATCTTCAAGAGCAAATCCACGGAGGGGTTCCAGTCGGTGCCCTACG
TCGTGGCCCTGTTCAGCGCGATGCTGTGGATCTTCTACGCACTGGTCAAGACCGGTGAGGGCCTCCTCATCAGCATCAACGCTGCCGGCTGCGTCATCGA
GACCGTCTACATCGTCATGTACCTCGTCTACGCCCCCAGGAAGGCCAAGATTTTCACAGCCAAGATCGTCGTCCTCCTCAACATCGCCGGCTTCGGGCTC
ATCTTCCTCCTCACCCTCTTCGCCTTCCATGGCGAGACACGCGTCGTCACACTCGGCTGGATCTGCGTCGGCTTCTCCGTCTGCGTCTTCGTTGCCCCAC
TCAGCATCATCGGACGAGTCATCAAGACCAAGAGTGTGGAGTACATGCCCTTCACGCTCTCCCTGACGCTCACCCTCAGCGCAATCGTCTGGTTCCTCTA
CGGCCTGCTCATCAAGGACAAATACGTCGCGCTCCCAAACATCCTTGGCTTCACCTTCGGGGTAATCCAGATGGTCCTCTACGTGTTCTACATGAACAAG
ACGCCGATGGCAAGCCAGGTCAAGGAGGGGAAAGAGGCATGGAAGGCGCCCGCAGAGGACCACGTCGTCGTGATCAACGTCGGCAAGGCCGACAAGAGCT
CGTGCGCCGAGGTGCGCCCGGTCACCGAGATGGCCGGCGCCGTCGACGTCCCCAGGAGATGCGCTGCTGAGGCGGCGGCGCCGGGGCAGCAAGTGATGGC
GGTGGACTTTGCCCGTTCTGTCGAGGTGGTCTAGATGCAACCATGCATGGCTCATGCATGAGTCGTCCAAGCTTTAATATTCGAACAACCTTTTTGGAGG
GTATGCAGGGCTCTAGATTCCCGCATGCAGGGTATGCGATGCCTTTGTTCTGTTATATCAACGTGTTGATAATATGAGGCATAAACAATATGTATCTGCA
GTGTATAGTGCAGTTGCTAGTATTGTTGCCCATCTGGAGTTTCC
page-top