Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12140  (registered. 2012)
Contig Information
Length 1197 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 1
WH_XN Leaves, plant was grown at constant 23 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|61378666|gb|AAX44980.1|| ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit"
Score 698
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12140
AGAGAGAAAAGGGGACCAGGACTTGATTTCGTTGCCCAAGCGAATCCCATTCAATCGTTTACTCATGGAATGAGTCCGTTGGAAAGTTCAATCAATCTTT
TTTTCATATACATTTTTTTTTTTTTTTTTTTATTTCGTTTCTTTTTTATTTATACCTTCTCTTCTTTATCTTTAGTTTTATCTACTTATCAATAGTATCT
ACCGGCTCGAACTCGAATTTGATCGCCTTCCATACTTCACAAGCTGCGGCTAGTTCAGGACTCCATTTGCAAGCTGCTCGGATAATTTCATTACCTTCGC
GAGCAAGATCGCGCCCTTCGTTACGAGCTTGTACACAGGCTTCTAAAGCCACTCGATTAGCTGCTGCACCAGGTGCATTTCCCCAAGGATGTCCTAAAGT
TCCTCCACCAAATTGTAATACAGAATCGTCCCCAAAGATTTCGGTCAGAGCTGGCATATGCCAAACATGAATACCACCTGAAGCTACCGGTATAACACCT
GGCATGGATACCCAGTCCTGAGTGAAAAAGATACCGCGAGCACGATCTTTTTCAATAAAATCATCGCGCAATAAATCAACAAAACCTAAAGTCATTTCGC
GTTCCCCTTCTAACTTACCTACTACTGTACCGGAGTGGATATGATCTCCCCCAGACATACGCAATGCTTTAGCTAATACACGGAAATGCATACCATGATT
TTTCTGTCTATCAATAACTGCATGCATTGCACGGTGAATGTGAAGAAGTAGGCCATTGTCGCGGCAATAATGAGCCAAAGTAGTATTTGCGGTGAATCCC
CCAGTTAAGTAGTCATGCATTACAATAGGAACCCCTAATTCTCTTGCAAATACAGCTCTCTTAATCATTTCTTCACATGTACCCGCAGTCGCATTCAAGT
AATGCCCCTTGATTTCACCGGTTTCGGCCTGTGATTTATAAATAGCTTCGGCACAAAAGACNAAACGGTCTCTCCAGCGCATAAATGGTTGTGAGTTTAC
GTTTTCATCATCTTTGGTAAAATCAAGTCCACCACGTAGACACTCATAACACGCTCTACCATAATTTTTTGCGGATAATCCCAATTTTGGTTTAATAGTA
CATCCCAATAAAGGACGACCATACTTGTTCAACTTATCTCTTTCAACTTGGANNNCATGAGGCGGGCCTTGGAAAGTTTTTGAATAAGTAGGGGGAA
page-top