Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12118  (registered. 2012)
Contig Information
Length 1101 bp
Clones alternative view 53 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 4
Wh_yd Spikelet at late flowering 2
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 4
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 3
WH_XB Root 2
WH_XD Root, treated at 50 microM Al for 6h 7
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|212721644|ref|NP_001132525.1|| hypothetical protein LOC100193988 [Zea mays]
Score 317
Evalue 1.00E-84
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12118
CTTTGATAGTGTACAACATCAACGATCAGATATTAATCATACATCCAGAGTACACATATACTCCTGAGAAGTCGATTTTCATGTGTTTACTTGCCGGGCA
CAAAGTTGGTGGCGAAGGCCCACGCGTTGTTGTTGACAGGGTCGGCGAGGTGGTCAGCGAGGTTCTCCAGCGGACCCTTACCAGTGACGATGGCCTGCAC
AAAGTATCCAAACATGGAGAACATTGCAAGGCGGCCGTTCTTGATTTCCTCCTCGTGCCGAATTCGGCACGAGGTTTTTAAGTGTTCATCAACCATTTCC
ACACTATAACTTTTTACATATGATGCCCCTAAATTCATGAGGCAGGATCAACAACACAACATAAAAGAACAGTAGCACGAGACATGACACAAAATTACCA
CGGAGACAAAAGATACTTTGACGGTTTGACCTGTAAGCAATAACTGGAGATGTTTAACATTTCATCTGAGAAGCAACTATAGAGCGCCCTAAACAAAGGT
TTCATGGTTGCTTATTGCAACTTTCTGGCAGCGGCCGCCTCGCCCTGCCTTAGTCAGCAGTCCAGCTCTGCTCCACGATCTCGCGGACTTTGCGGTTGTA
CTCTCGCTTGTTCTCGCTGAACATTCTGGCAGCTTCCGAATTTGCTGGAGAGTTGGGGTTTGGATCACACAGCAAGGACTGAATAGAAGTCAATATGGCA
GCAACGTCATATATAGGGCTCCACTGGTTCTGTAGAATATCCAAGCAGATGCTCCCATCTGCATAAATATTTGGGTGAAACATCCTAGAGACAAAACGAA
CAGTTGGCGGCTTGTTGGGGTAATCTTCTGTAAACTGCAAGGTAAGCTTGAACGTGCCTCCGTCCCATGGCGTATCATCCGGCCCGAAGATGACGGCGTT
CCAGAGCATGATGTTGTTGTCGTGCGGCGCGCCGCTGATCCCGGCCGGTGGGTCATGCTGCAGCCGCTTGAAGTCCCGCATCAGGCGCTTTCTCGACGGC
GTCGACATCTCCGCCGCCGGCGCAGACTCCTCGAACCCGCTAGGGCTCACGTACGCACGCACTCTCCCCGCCAGTCGCTTCGGCCAGGTTTATCCTCGTG
C
page-top