Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12108  (registered. 2012)
Contig Information
Length 1382 bp
Clones alternative view 30 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_yd Spikelet at late flowering 1
Wh_SH - 1
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_SHC Shoot grown with cold treatment 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XB Root 1
WH_XF Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218185879|gb|EEC68306.1|| hypothetical protein OsI_36387 [Oryza sativa Indica Group]
Score 726
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12108
TTTTTTTTTTAGTATTCATTCAGTATCTGTATTCTTATTTCCGGCCTCACGCTAGGCGGCACGAAATACATAAAGAATACGGGTGCTCACTTGGCGCAAT
TCACACTTATTAAAGTTGATTAAATATTCGGGCAGCCATCTATCTACGTTTGGCTCACAACAGCAGTAACCATGAAGTGGCTGGCTTAACTGCTCGCAGT
TATAGGTTCGGTGGCCTTCCTCAGCCATTCCTTCTCCTGAACATTTAGGTAAGACTCCAAGATTTTCTGGCAGTCGGAGTGGTACAAGTTTACCCATTCG
ATCTCCGCAGGGGTCAACAAGGCAGTATTTATAAGTTTAGTCTGGTATGGAGCCCATGTTATATGTTCAAATGACAAATAACCCTTCTCCCCAAAATTAA
ATTTAGTATCAGCCTCTTTGACTATAAGAACATTCTCCAACCTTATACCAAAGTTTCCATCTTCGTAGTAACCAGGCTCATCTGTTACAGTCATTGATGC
TTGCAGTGGTACATTGCGAGCAGAAGGTCTGAAGCTAATTAGATGAGGGCCTTCATGGACATTCAAATAAGATCCGATTCCATGGCCTGTGCCATGCCGA
TAGTCAAGACCACTTTTCCACAGTGGGGTTCTTGCCAGTATGTCAAGAGCATGACCTGTGGTCCCATTAGGAAACACAGCAGCATCTAGGGCAATGTGGC
CTTTCAAGACAGCTGTGTAGCACGATTTCTGATGCTCTGAGGGTTTACCAAAATGTACAGTTCTTGTAATGTCTGTAGTGCCATCCAGGTACTGTGCCCC
AGAGTCACAGAGATATATTTTATCAGCATCAAGTTCCGCACATGTATTTGCCTCAGGAGAATAGTGAATTATTGCTGCATTTGGCCCCACAGATGATATC
GTAGGAAAACTTAAACCTTTAAAATGCTCTTTCTCCGCACGGAAGGCTTCGAGTTTATCACTGACAGAAACCTCAGTAAGTTTTATTTCCAAATGCTCTT
TTTTCTGTGATCCATTGGCCTCACTGAAGTAACCAGAGGCCCCATAGTTCTCTTGCATCTGATTATCCAGCCAAGCCAGGTATTGCACAACAGCTGCGCC
ATCTCGAATGTGTGCCTTCCTCAAACCAGTCAGCTCCATGGGATTCTTGACAGCCTTTGGTAGAGTAATGGGCGATTGCAGCATCAAAGCTTGATCTGGT
CTAAGCTTTGAGTAGAGTGCAAGGCAACACGAATTTGAATCAATCCAGATTTTGGACTGTTCCGCCACGTTGATATCCTTTTCCATGTGCAAGCTACCAT
TAACTGCAGAGCCTTTCAGCTGTCCAGATGCAAGCAAGCTCACATCCAGCTGAACCATATCATACTCTCTGATATCAATACC
page-top