Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12080  (registered. 2012)
Contig Information
Length 774 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_VSCB Liquid cultured tissue 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115478683|ref|NP_001062935.1|| Os09g0345000 [Oryza sativa (japonica cultivar-group)]
Score 206
Evalue 3.00E-51
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig12080
GCTGCCTCCCTCAAAGCCCTCCAGTCCTCGTCCTCCACGGCTTCACCACCGAGAAGCAGGATTCTCATGGGCTGCGCAGGATCCACCCCCAAGGGCGCTG
CGGCCGCCGGAGGCGAAGCTACGAAGAAAGTCAGGAAGCCTAAGCCCTGGAAGCACCCCCAGCCGATCACAATTGCCCAGCTCAGGCAGATGCGTGATGA
GTTTTGGGACACAGCTCCTCACTATGGTGGTCGGAAAGAAATTTGGGATGCCCTTCGTGCTGCGTCAGAGGCTGATGTAGCCCTTGCACAGGCAATTGTG
GAAAGTGCGGGCGTAATTGTTTCAAATGCTGACCTGACTCTATGCTATGATGAAAGAGGTGCTAAATATGAACTGCCCAAGTATGTTTTGAGTGAGCCAA
CCAACCTGGTCCAAGACAGTTGAAGGGCAGCTGCACTATGATCCATTCATGTAAAAAACTGTAAATCGCTTCAGATGCTAAAAACAATGCCTTGCTCAAG
TGTCCTGGTGACAGGAGCATGGTTGATTAATGATTTCAAGCATGCTTCTGGTAACTGTCAGCTTACAGTTTCCCCCCTATCGTTAGCATACAATGTTCTC
TTCTATCTCAGACTGTCTTCCGACGATTTAGATAAAGTTGTTCATAGCATCCCCTAAATTGGTGCTGTTAGAAATCTTCGGTATGGGTTAGAAACTTCAG
ACTGGTGCGTTGATGTTTTGTTACAATGATATAAGTTGAAGTATGGCAATACATTTCAGAAAGAAAGAAAGAGA
page-top