Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1208  (registered. 2012)
Contig Information
Length 1633 bp
Clones alternative view 23 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 4
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 1
WH_XB Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115486297|ref|NP_001068292.1|| Os11g0620100 [Oryza sativa (japonica cultivar-group)]
Score 774
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig1208
TTTTTTTTTTAAAATAAGAATTGCCCAACTCTTAACACGTCAGGGATACGTATGTTCTAGTACATTGGTGCTATATATAGCCGGCGACCCGGAGCGTTAA
CAGCGGCGAAGGATAGTAAATTACTAATTGCGATGTTGAACTAGTAATAACAAAAGAAAAGGCCCTGGTGAGGCTTCATCAACCATATATGTATATATAT
TAGGAAGGAGGGTGTTGTAGCCCCCTCCGTCGCCAGCATACTTGCTTCATACACTCAGTAGTACATGAGCTGCTGCTGCTGCTGCTGAGGGTTGACACTC
TGGAAGCCCCCGTCAAAGATGGCCTGGCTGGCGCCGGCGCCCATACCCATCGCGGCCTGCCTCAGGGCGGCGTGCTGACCCATCAGGGCCTGGTTGGCAG
CCATCTTGCTCAGAGCAAGGGATCGCTCGTAGGAGATGAGGTCAACTGCTGACACGCCAGGCGTGTATGGCGCTAATGCCGGAGGAGGCAGAGGCGCAGA
TGCTGTCCCTGGTGGAGTTGGTTTGCTTCCCCAAGAGCACTTGATCTGCCTCCCGCCAATAAATTGGCCATTACCCGTCTGTATTGCTTGTGCAGCTTCT
TCATGGGTACTATATCTCACAAAGCCAAATCCTTTATCGCGTGTTACACGGACCTCCTCAATTGACCCAGCCCCGAGTAAATGGAAAAATCGATGCACAT
CATTGCTGTTGATATCATGGGGAAGATTGCCAACATAAACAGTTGTATACTGTGGGTTATTTTCAGGACCATCTTCATTTGCATTCTCCTTGCCAGGCTC
TGATGAGCCGTTTATCAACTCCACCACACCCTTGGAGTCTGTACTTTGCTTCTCTTCACCAGCATTAGCGCCCTTCGTTGCCCAATTGCAACGAATTTGG
CGGTTGCCAAGCCACTTTCCATTCAATTCATTTATGGCAGTTTGTGCATCCTGCTGATTCCTAAAAGAAACGAAACCAAAACCTCTGGATCGTCCAGTCT
GCTGATCCCACATAACTCTAGCATCTGAAGAGGTAGAATATGCCGAGAAAAAAGCAAACAAAGCAGCATCCGTAACCTCCGGGCAAAGATCCCCGACGAA
GATGTTAAAATGACCTGATGTATCCTCTCTCTGGGTACTTGCGTATGCCCAATTGACTTTTATTGGCTGGCCAAACAGTTGTCTACCGTTGAGTGACACG
ATAGCAAGTGCAGCATATCTACGGTCATAATAGTCAACAAAACCAAAAGATGACTTTTCTTTCCTGATGAGCTTACACCCTTCAACTGGACCAATACTCT
GGAAAACTTCATGCAGTAGTGAATCTGTGACTTGAAGATGGATGTTGCCAACATACACACTGCGGCATGTGCTTGAATCAAACCCAGGAGGCAGGTTCCC
ACTAACGATGGGCTCTATATGCGGCGCGGCAAGGAGACCCGGGTGCGCGTGGTGCGGCGGGAACATGGGCGGCACTGCGGCCGCCGCCTGCTGCTGCTGC
TGCTGGTGGTGCATGAGCAGCGCCTGCTGCATCATCTGCTGCTGCTGCTGCTGCGCCGCTACCGCCGCCGCCTGCTTCATCCTCTGCTGCATGGCGATCG
ATCCCCGGCCCGTAGTCCCGGGTCAGGGAGATC
page-top