Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25417  (registered. 2007)
Contig Information
Length 2224 bp
Clones 429 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 103
Wh_DPA20 Seed DPA20 10
Wh_EM Dormant seed with water absorption 22
Wh_EMC Dormant seed with cold treatment after water absorption 13
Wh_EMI Dormant seed with water absorption after breaking 30
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 8
Wh_KMP Shoot grown under continuous light 24
Wh_KMV Shoot grown with continuous light after cold treatment 22
Wh_MS Seed DPA5 of DT3DL CS wheat 16
Wh_OKCS Seed DPA5 41
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 25
Wh_SHDr Shoot grown with dessication 16
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VABA Shoot with ABA treatment 21
Wh_VHS Shoot with heat shock treatment 6
Wh_VSCB Liquid cultured tissue 29
Wh_VWD Shoot grown with dessication 28
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit S-adenosylmethionine decarboxylase precursor [Triticum aestivum]
Score 1244
Evalue 0
Total Hit Count 356
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25417
TCGTTAGATAGGGGGAATTCATATAGCAATTTCTGAGCCGTATGAGGTAGGAAGATAGGCGAGGGGAAATGAGCACATTGGTCGCCTGTCAACACACTGC
AACTTGGCACAGAGTAACACCAATTACAGAAGAGTGCTGCTATGCACACGACATGTTCCAGCCGATTGTTGGACGATACTGCAATTCAGGCCATCGATAC
CTAGTACTAGGTGCAACACAGCCACTAGATTAAGAATCGTGCTTGAATCGTCCAACAGCTATCGGCTGTGAAGTAGTTTCGATTACAGAACATGAATATG
ATAACAAAGTGACACTCGTCTTAGAAAAAAAATGCTTATTTATCAGTTTGAGACAACTTCTCCCCAGAAGTACGCTCATTGTGGCAGACGCAGTCAAACC
ACCTAGAGCTAATAGTTTATTCGGAGTAGCAATAGCCTGGCCAGCTGCTTCACAGTAACCAAACGACAAACTTAGTCAGAACAAAGTCCACAGACGGAAC
AGCGACAGCCAATCACTCGCACAGCACCGCGCCCTCCTCCAGGGAATCCTCCTCCGCCCGCCATGCGAGGAGGTTGGCGAGCTTGCCTTCCTTGACCAGA
GGGTGGCTCTGCACACTCTCGGCCTCGAAGCAGTGGAAGACGGACCTGGGCGACCCGGCAGAGACAGCAACCTCTTCGTTCGCGGCAAAGCTCTGGTAGA
TGAGGACGCCCCCGCAGGGGAGCTCCTGCTCCACAACGTTGTTGCAGTCGTATGCCTCAGCTTCGAGCTTCTTGCCCCAGGTGGCGGCGTGGCCACGGCC
ACCGAAGATGGTGACCGCCACAGAGAACTCTGAAGGGCCAAAGCACCGGAGGACCCTCTTGACGATGTCGCCGTAGGCCAGGGCGGAGGCGTCCATGCCC
ATGACCTCGTAGCTCGCGTAGCTGAAGCCGTCCTCGGGGGTCACATGGATGGTGGAGACGGCAGATCCCGTTGATGGCGTTCATGGAGTAGCCGCAGGGC
TCGAAGTCGAAGTCACAGACCTCCATCTCAGGGATAATGTCAGAGATTCCAGAGAGCTTGGTCATCTCCTTGGCACAGGAAACGTGGCCATCAGCTTGAG
TCTTGAAGAAGACAGAGGCCTTCTTCTTGTCCAGCCCAGTCATGCACATCTCCAGGGTGACCATGGGCTGCTCAGGTTGCTCGGTGGCATAGTAGATGTG
CCACTTCTGGCCAGGCTTCGCTGGGTCTCCGATCACATAAGCATTGCCACCAGACTTCAGGTGGCCGAAGTAGCGGTTCAGGACATCAACCTCCTCAGAG
AAGCTCCTGTGGGGAGCAGGCTGTGCGCCGGGGAAGATGAACATCCCACGAGAGTACTTGACGGCAGCAAGCGGCATGCACAGCTCTTCAGCAAGCTCAA
GAATCCTAGGAATGGTGAGCAGGAGCATGGTAGTCCCACAGGTCTTGATCACAATCTTCTGAGAATAGATGAACAGGCTGGACTCAGATAGCACATACGA
GTCGAAGTCCTTGTTGGAGAGCTCGGACACAATGGTGCACCGTGCAAGATCAAGAACAGAGTCAATCTGGGCCCTAGAGAGGGCGCGCAGGCCACGACCA
TGAGGGTCGGCAAAGATCGATGCCTCGGAGAAGGTGATCTCGAGGCGCTTCTCGTAGCCCTCGAACCCGATTGCAGAGGTCGGGGCAGCCATTGTTGCAG
TTTGAGTCAGAAAGCAGAGCAGAGAGGAACAGAGGGAGTAAGACTAGAGAACTGGTCGATTATCGTGAAGCAGGCCAGAGAGATTGGTGGGAGAAAAGAG
TCAGAATAAAATTGCATAAAAATCCTAAACTACGGGAAGGGGATGCCAAAAACGATATCAGGATGGCTTCTTCGCGCAGTTCGAGTATGCAGCAGAGAAC
TTCTTGGCGCCTCCAGCAGGTCGAACGTCTTCAATGCTGTAGCCGAGGGGAGCTTCGTACATCAGGGAACTACTACTGCTAGACTTTTTGCCACCCTTTG
ACTCCATTAGCACATTCACTAAAGGTTCCTGGGAAAAATTGTATGGTAACCCCGATCCCGAGCGCGCCCGCTTGTTCCGATTCCGATCTCAAGAATTCCC
CCTCTCCCGACACGAGATCTCGAGCGACTCCCAACGAGTTCTGCTCTCTCTTTTTTTCTTATCTAGCTGTGGTGGCGGCGGCGAGACGGTGGGGGTGGGA
GGAATTCTTGTGCAACGAGTTGCG
page-top