Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25412  (registered. 2007)
Contig Information
Length 3170 bp
Clones 342 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 19
Wh_KMV Shoot grown with continuous light after cold treatment 21
Wh_MS Seed DPA5 of DT3DL CS wheat 8
Wh_OKCS Seed DPA5 4
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 52
Wh_V483 Shoot grown under cold condition for 3days 54
Wh_VABA Shoot with ABA treatment 50
Wh_VHS Shoot with heat shock treatment 79
Wh_VWD Shoot grown with dessication 50
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit chlorophyll a/b-binding protein WCAB precursor [Triticum aestivum]
Score 1181
Evalue 2.27388e-136
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25412
GGTTTTTTTTTTTTTTTTTAAGCAAGAACACACAGAAGTATTTATCTGTTCTCGTGAACCATCATATCACAACAAAATGGTCAGACCGATGCAAGGTGCG
ACATGGAAGTGGACAAACCGAACCGTGCTTTTGCACAAATTTCTTGTAATTTACATCATGATAGTACAACTCAGGCCACAGGAGAACATGCCTCATTGCG
AGCACAGTCCCAAGACACCTTACTTGCCGGGGACAAAGTTGGTGGCGAATGCCCCATGCATTGTTGTTGACGGGGTCGGCGATGTGGTCAGCGAGGTTCT
CAAGTGGGCCCTTGCCCCGTGACGATAGCTTGGACAAAGAAGCCAAACATTGAGAACATGGCAAGGCGACCGTTCTTGATCTCCTTCACCTTGAGCTCGG
CGAATGCCTCAGGGTCTTCGGCCAAGCCAAGAGGGTCGAAGCTACCGCCTGGGTAGAGTGGGTCAACGATCTCACCGAGTGGGCCGCCGGCAACACGGTA
CCCCTCGACGGCACCCATGAGCACGACCTGGCATGCCCAAATAGCTAGGATGCTTTGTGCGTGCACTAGGCTGGGGTTGCCGAGGTAGTCGAGACCACCC
TCACTAAAGATCTGGGAGCCGGCCTTGAACCAAACGGCCTCGCCAAACTTGACGCCGTTGCGGGCGAGCAACTCAGGGAAGACACAACCAAGTGCCCCAA
GCATGGCCCAGCGACAGTGGATCACCTCCAGCTCCCGGTTCTTGGAGAAGGTCTCCGGGTCAGCCGAAAGTCCAGCAGTGTCCCACCCATAGTCGCCAGG
GAACTCACCGGTCAGGTAGCTCGGAGGCTCACCGGAGAGTGGGCCGAGGTAGAGCACACGGTCAGCACCGTACCATGGGCTGCCGGAGGAAACCTGCTTT
GCCTTTGCTGCGGTCTTGCGCATGGTGACGCGGGCCTCGCCCAAGAGAGCCAAAGATGGTACATTCTTCACCGCCTTGCCGGCAAAGGTCGAGGAGGAGA
GGGACATGGTGGCTGCCGCCATTGGAAAGCTAACAAAAGTGTCTGATGTGTTGTATGGGTTCTCAAAGAGATGAGTGACGGTTAAGGGTAATGACTTCAA
ACATGGCCAGCTCCTATAGTGTGACGGGCGGTGTGTACAAGGCCCGGGAACGGATTCACCGCCGTATGGCTGACCGGCGATTACTAGCGATTCCTGCTTC
ATGCAGGCGAGTTGCAGCCTGCAATCCGAACTGAGGACGGGTTTTTGGAGTTAGCTCACCCTCGCGAGATCGCGACCCTTTGTCCCGCCCATTGTAGCAC
GTGTGTCGCCCAGGGCATAAGGGGCATGATGACTTGGCCTCATCCTCTCCTTCCTCCGGCTTAACACCGGCGGTCTGTTCAGGGTTCCAAACTCATAGTG
GCAACTAAACACGAGGGTTGCGCTCGTTGCGAGACTTAACCCAACACCTTACGGCACGAGCTGACGACAGCCATGCACCACCTGTGTCCGCGTTCCCGAG
GGCACCCCTCTCTTTCAAGAGGATTCGCGGCATGTCAAGCCCTGGTAAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAG
CTGGAGAGTGGCAACGCCGGAGAGCCAGCCAAGCTCATCAGGCAGCGGTACCGTGAGGCTGCAGACATGATCAAGAAGGGTAAGATGTGCTGCCTCTTCA
TCAACGATCTTGACGCCGGTGCGGGTAGGATGGGCGGGACCACACAGTACACCGTCAACAACCAGATGGTGAACGCCACCCTCATGAACATCGCCGATGC
CCCCACCAATGTGCAGCTCCCAGGCATGTACAACAAGGAGGAGAACCCACGTGTGCCCATCGTCGTCACTGGTAACGATTTCTCGACGTTGTACGCCCCT
CTGATCCGTGATGGTCGTATGGAGAAGTTCTACTGGGCTCCCACCCGCGACGACCGTATCGGTGTCTGCAAGGGTATCTTCCAGACCGACAATGTCAGCG
ACGAGTCCGTCGTCAAGATCGTCGACACCTTCCCAGGACAATCCATCGACTTTTTCGGTGCTCTGCGTGCTCGGGTGTACGACGACGAGGTGCGCAAGTG
GGTGACCTCTACCGGTATCGAGAACATTGGCAAGAAGCTGGTGAACGCCACCCCTCATGAACATCGCCGATGCCCCCCACCAAACGTGCAGCTCCCAGGC
ATGTACAACAAGGAGGAGAACCCTCGTGTGCCCATCGTCGTCACTGGTAACGATTTCTCAACGTTGTACGCCCCTCTCATCCGTGATGGTCGTATGGAGA
AGTTCTACTGGGGCTCCCACCCGCGACGACCGTATCGGTGTCTGCAAGGGTATCTTCCAGACCGACAATGTCAGCGACGAGTCCGTCGTCAAGATCGTCG
ACACCTTCCCAGGACAATCCATCGACTTTTTCGGTGCTCTGCGTGCTCGGGTGTACGACGACGAGGTGCGCAAGTGGGTGACCTCTACCGGTATCGAGAA
CATTGGCAAGAAGCTTGTGAACTCGCGGGACGGACCAGTGACCTTTGAGCAGCCAAAGATGACAGTCGAGAAGCTGCTAGAGTACGGGCACATGCTCGTC
CAGGAGCAGGACAATGTCAAGCGTGTGCAGCTTGCTGACACCTACATGAGCCAGGCAGCTCTGGGTGATGCTAACCAGGATGCGATGAAGACTGGTTCCT
TCTACGGTTAGAACATTCTCCATACACACCCACCATCTCTTGCTGCATAGGAGGAGGTGAACTACGCACAATCCTTTTATACTTTCAGCACCTACTTTAC
ATACATACTTACTTCTCACTTGCTTACTTCTGAAACAAAAGAGAGTGAATCATAAACAAACAGTGGAGGCCTATTCTTCTTACCTGTTCTTCTGGCATAT
CAAGCTCATCTTTCTCATCAGATCGTCCAAAACAATTAAATTGCAGGTAAAGGGGCACAGCAAGGTACTTTGCCTGTACCGGCAGGATGCACCGACCAGA
CTGCCAAGAACTTCGACCCAACGGCGAGGAGTGACGACGGCAGCTGCCTTTACACCTTTTAAGCATGCCAATTTAATATCTGATGTTTTATCCTTTGTAC
CTAAGTACCGCATCGCATCCAAGCGATTGCTGGGCATGTTTTGTTAATATATAAAGATATTGAGTATACC
page-top