Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25409  (registered. 2007)
Contig Information
Length 1597 bp
Clones 328 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 18
Wh_KMV Shoot grown with continuous light after cold treatment 43
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 5
Wh_PCDAM Anther at meiosis 10
Wh_SHDr Shoot grown with dessication 10
Wh_V4816 Shoot grown under cold condition for 16days 71
Wh_V483 Shoot grown under cold condition for 3days 35
Wh_VABA Shoot with ABA treatment 4
Wh_VHS Shoot with heat shock treatment 74
Wh_VWD Shoot grown with dessication 48
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0592500 [Oryza sativa (japonica cultivar-group)] >gi|122246902|sp|Q10HD0|CB23_ORYSJ RecName: Full=Chlorophyll a-b binding protein, chloroplastic; AltName: Full=LHCII type I CAB; Short=LHCP; Flags: Precursor >gi|152013384|sp|A2XJ35|CB23_ORYSI RecName: Full=Chlorophyll a-b binding protein, chloroplastic; AltName: Full=LHCII type I CAB; Short=LHCP; Flags: Precursor >gi|50839002|gb|AAT81763.1| chlorophyll a/b binding protein [Oryza sativa (japonica cultivar-group)] >gi|108709618|gb|ABF97413.1| Chlorophyll a-b binding protein, chloroplast precursor, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113549057|dbj|BAF12500.1| Os03g0592500 [Oryza sativa (japonica cultivar-group)] >gi|125544706|gb|EAY90845.1| hypothetical protein OsI_12453 [Oryza sativa Indica Group] >gi|125586998|gb|EAZ27662.1| hypothetical protein OsJ_011145 [Oryza sativa (japonica cultivar-group)]
Score 1168
Evalue 1.02315e-125
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25409
GCTTGCATGAGTTTCAAAGGTTACGATCTGAAAAGGATTTCAAACGAGAGAAACTGGGTTTCTGAACCAAGAATAGCCACAAAGACAGAGTTGTATAGTT
GGCCCGTTGGATCTCCGTATGCCGTTGCGAATGTCCCGTTTCATGAGCTTGAAGTACCATATACGCCATGCCAGTTGATGATCTCGAGTAATGTACTAAT
GATACACGATTCTTCCATCCATTTGCTCGTGCATCTCGTGCTTAATTAATTTACATTGCCGCGCAGCCAGGCGAGAGGTCATCTCGCTCGCTCGATCATG
GTACAAATAAACACACAAAGCTACGTGCAGCTACACGCTTGATCCACGACGTACAAGTACACATGCATATCTCGTCCGATGGACGGACAGATGGCTTAAC
ACATTTAGCTTCCGGGGGCGAAGTTGGTGGCGAAGGCCCACGCGTTGTTGTTGACCGGGTCGGCGACGTGGTCGAAGAGGTTCTCTACGGGCCCCTTTCC
GGTGACGATGGCCTGCACGAAGAAGCCGAACATGGAGAACATGGCGAGGCGGCCGTTCTTGAGCTCCTTGACCTTGAGCTCAGCTGCGGTGTCGGGGTCG
TCGGCGAGGCCAAGTGGGTCGAAGGCGCCGCCTGGGTAGATGATGTCGAGGCCCTCGCCGAGGGGGCCGCCACCAACGCGGTAACCCTCGATGAAGCCCA
TGAGCACCACCTGAACCGCCCAGATGGCGAGGATGCTCTGCGCGTGCACCAGGTTGGGGTTGCCCAGGTAGTCGAGGCCGCCCTCGGAGAAGATCTGGGC
ACCGGCCTTGAACCACACGGCCTCGCCGAACTTGATGCCGTTCTTGGACAGGATCTCCGGGAACACGCACCCCAGGGCGCCGAGCATCGCCCACCGTGAG
TGGATCACCTCCAGCTCCCGGTTCTTGGCGAAGGTCTCTGGGTCAGCCGACAATCCGGCGGTGTCCCACCCGTAGTCGCCGGGGAACTCGCCGGTCAGGT
ACGACGGGGTCTGCTCGGAGAACGGGCCCAGGTACTTGGGACGGTCAGGGCCGTACCAGATGCTCTGGGGCGCGCTCTTGACGGTCCGGCGCATGGTGAT
GCGGCCGCCGAAGTCGCCGACGCTGCGGAGCGAGGTCATCACGCCGCGGGGCGGTGCCGAGGAAGGCTGGTCGTCTGGTGCAGCGCCGATCGCGGCCATT
TCGGCTGGTGGCTGGGGCTGCCTGCGAGCTCAGTGAGATGAACAAAAGACTTCTCCATGGGTAATTAACTCATGTTCAACAATTACATCATTCAGTATCC
ATCAAAACATAAAACCACGAGCAAACATTACTGGAATTGAAATTAAGCATTCTATTAAGTGCTCCAATCCTTCATCCNTGATCAGCTTCACTTCAGGGTA
CCAGGAACAGGTGAATTAACGGTACTTGATGAAGCCAATGTCCTTGGCGTTGCTGCGGAAACACTGCCTGCAACACATCAGCCCATACTTCCTGATCAGT
CCATGGGAGTTTCCACAGACCCGGCAGACGCGGGAGCCGGGCCCGTAGTTCTTGGGGTGGGAGTTCCAGACGTTGGAGTGCCCCATCGTCGCCGCCT
page-top