Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25405  (registered. 2007)
Contig Information
Length 2764 bp
Clones 300 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 51
Wh_DPA20 Seed DPA20 35
Wh_EM Dormant seed with water absorption 15
Wh_EMC Dormant seed with cold treatment after water absorption 19
Wh_EMI Dormant seed with water absorption after breaking 8
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 8
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 14
Wh_KMP Shoot grown under continuous light 13
Wh_KMV Shoot grown with continuous light after cold treatment 19
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 14
Wh_PCDAM Anther at meiosis 6
Wh_RDr Root of dessiccated seed 16
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 9
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 7
Wh_VABA Shoot with ABA treatment 4
Wh_VSCB Liquid cultured tissue 42
Wh_VWD Shoot grown with dessication 11
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit pyruvate kinase, cytosolic isozyme [Zea mays]
Score 1480
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25405
AAATCGCTTGATTCTAGCGAGTAAAAGCCGAGGCATTGACCAAAACATAACCACACCAATTTCACGATTACCATTACAAAGCAAATCCCACAATTATCAG
AAAGTTTTCAAGACACTCAACATCTGATAGTTACCGACACAACATTGGAGAGTCGACTGACAACCATAGAGCAGAGCAAAAATACTGACGACCGCATAGA
TTTTAGCATACAGTGCGATTAGCACTTGACCTCTTTCAGCCCATGTGCAAAGTACAGGAAAGTTGGATCAGCAGCTCCCTCCTTGTAGTAGGCGAACACC
ACGCCGCCATCATCATGCATGCTCTCGCCAACAAAGAACTGAAGGTCCTTGAGCTTGCTAAGAAGATACTTTGTGGCAGACTCAACATTCTTCTTGAAAA
CATCTAGGTCATCCCCTTCAAGCTTGGCAGAGAGGTTCTTGATGTAGCGCTTCATGTGAGAGATAAACTGCTTCTTGTCAAAAGCAGGTTGCTCCTGAAG
ACGGAAGGTGTCAACAATGTCAACCACCTTCACGGCCTGGTCATCGACACCCTCATCATCACCACCACCCTCAGCAGAGGGATTGGCTCCAATGTCCACA
TCAACTGCTCCTTGAACGACCCAATGGCCGTCGACTTCCCAGAGCACGCCGTTCTCCAGCTCCCTGTACGGGAACGAATCCGACAGAAGCTCGTCGCCGG
AAAGCTTGTCCTGGTACACGAGCATGGTGCCGCCTCTTGAGATTTCTCCCCCGAAAAAGGAGAAAACCCTAACGAGCTCTGGGGGAGGCAGGGGAGTAGC
GGTTTTGGTCACAAAGTTTTGATATCATTATTCCATCAGATAATTTACTCGCTACACTGCAGTAAAATCTGAGGACATATCCATAATAACTAGCGTAGGT
TTTAGAATGGTAACCGCGGATCCTATGATGACACCATAGGAAAAACTGCTCGTTTTGCAAAACTATAGATAGAATTATACATAGCCACCAAGCAACGTTT
TGGCCTAGTCAAAAATCTGGCAAGCCCTGAGCAAAGGCTAATTTTGCCTAGTCGTCCAGCTCAATGATCTTCACGACAGAGGAATCTCCCACTTTCTGGC
ACACGACGACGCGGTCATGCGACTTGATCACACCAGATGCTTTGCCGTGGTCAAGAGCAACCTTCAACACTGATTCATTTGTAGTGCTAGTAGATTCAGC
CGGATGACGTGGATCGGCAAGCATGGGAAAGAGACCTCTAACTATGAGTGATTGTCTTGCCTCAAATGCACCTGTGAAGCTCCACTTCAATTGATTTGTT
TTCAGACGAGGAATGACAACAGAGAGGACAGGCATGGTGGGCCTGTACTTGGCAATTAGCCTTGCAGCCCGTCCAGATGAGGTGAAGCAAATGATGACCG
AAGCCTTAACTTTAATAGCAGCCCGCACTGCAGAGGAAGCAATAGACTCCAAGTGGGTCATGGGTTCTCCCACATATTTCACAGTTCGCTTAAAGTACAA
ATCTTGGTTGAAGACCTTCTCAGCCTCAGCACAAATTCTGCCCACTGTTGAAATAGTCTCAACTGGATACAACCCACGGAGAGTCTCGGCACCAAGGAGA
ATGGCATCACTACCATCCAGCACCGCATTTGCCACATCAGTTGCCCTCCGCACGAGTAGGCCTTAGGTTGTCCGTCATACTGTCCACAACACGAGTAACA
ACAGCAGGCTTTCCAGCCATGTTGCACTTGTGCAGAGCAGACTTCTGAAATAAGAACACCTTTTCAGGTGGAAGATCAATTCCAAGGTTCCCTCTTGAGA
GAATGATACCATCCGCTTCCTCCAGGATCTCATCAAAATGGTTCAAGCCCTCCACATTCTCAATTTTGGCAAAAATCAGAGTTTGGCTAAGATCACCTAA
CTTAGAGAGGAACTCCCGTGCTTGCCGCACATCTTCTGCGTGCCTTGTATAAGAAAGAGAGAGGAAGTCAATCTTGTTTGGAGCACCCCCATTTTTTTCA
TAACATCTTTATCCTCATCAGACAGGCGTGGGCATGTCGATATGGATCTGGGAGCAGTGCAATGTGAAGAGTGACCCAGCCAGGGTAGCTGAGTTCTTGA
TCACGCAAACCACGTCATCCCCTTGAACTTCAGAAACCTCCAGCCAAACTGATGTAGTCTCACTGCCCGTGAACAAATATTGCCCAACGAATATTGTGGC
TCCGGGCTTCACAGCCTTGGCGAGTCCAGCGAAGTTGATAGGGAGCAACTTGGAAGAGGCCTCCTGGCCCTTGTGAGGGGTGAGAACAACAGACTCGTTC
TCTTCAAGCGAGATTGTGACTTCACTCTTGTTCACCACTTGCAACTCAGGGCCAACAGTGTCGAGCATAACAGCACATAGCTTCTTGGTGGCCTTGATGG
CGAGCTTGAGGTTCTCGAGTGTCTCCTGGTGGTACGCGGCATCCCCCCACGAGAAATCGAAACGGGCCACAGACATGCCGGCCTTTAGACAGGCGGAGAT
GGCCTCAACGGACCGGGACTTGGGACCCAGCGTCCCCACGATCTTCGTCATCGCCGGGAAGAAGTTCGGCTTGGATGGCTCGAGGATGGAGACCATCCGG
ATGGGCTCCTCGAGGAGCAGATTGGTGGAATGCATCTTCGCTGGCTCCTGAGATCAGATCGGCGGCGAGGGGCGACGGCGTCGGGAGGCGGGGGCGCTCG
CCCTCTCTTCTTCTTCTTCTTCTTCTTCTTCCCCAAGCAAGGGAGAGAAAGAGGAATGTTCGAG
page-top