Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25396  (registered. 2007)
Contig Information
Length 1003 bp
Clones 254 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 53
Wh_DPA20 Seed DPA20 26
Wh_EM Dormant seed with water absorption 12
Wh_EMC Dormant seed with cold treatment after water absorption 18
Wh_EMI Dormant seed with water absorption after breaking 15
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 7
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 6
Wh_KMP Shoot grown under continuous light 10
Wh_KMV Shoot grown with continuous light after cold treatment 14
Wh_MS Seed DPA5 of DT3DL CS wheat 14
Wh_OKCS Seed DPA5 11
Wh_PCDAM Anther at meiosis 5
Wh_RDr Root of dessiccated seed 16
Wh_SHC Shoot grown with cold treatment 6
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VABA Shoot with ABA treatment 3
Wh_VSCB Liquid cultured tissue 27
Wh_VWD Shoot grown with dessication 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Translationally-controlled tumor protein homolog; Short=TCTP >gi|21070379|gb|AAM34280.1|AF508970_1 translationally controlled tumor protein [Triticum aestivum]
Score 804
Evalue 8.61652e-84
Total Hit Count 335
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25396
TTTTTTTTTTGATCATTTTGCTTTGCTCAACGTTGCATTTACTGTGTTACAAAAAATGACCAAATACAAAAGACACAAGATAATCCGATAGAATAACAGG
GCAGAATCTCTTGATTCAACCAAAACACAACCACACCAATTTTCACGATTACCATTACAAAGCAAATCCCACAATTATCAGAAAGTTTTCAAGACACTCA
ACATCTGACAGTTACTGACACCAACATTGGAGAGTCGACTGACAACCATAGATAAGAGCAAAAATACTGAAGACAGCATAGATTTTAGCATACAGTGCGA
TTAGCACTTGACCTCTTTCAGCCCATGTGCAAAGTACAGGAAAGTTGGATCAGCAGCTCCCTCCTTGTAGTAGGCGAACACCACGCCGCCATCATCATGC
ATGCTCTCGCCAACAAAGAACTGAAGGTCCTTGAGCTTGCTAAGAAGATACTTTGTGGCGGACTCAACATTCTTCTTGAAAGCATCTAGGTCATCCCCTT
CAAGCTTGGCAGAGAGGTTCTTGATGTAGCGCTTCATGTGAGAGATAAACTGCTTCTTGTCAAAAGCAGGTTGCTCCTGAAGACGGAAGGTGTCAACAAT
GTCAACCACCTTCACGGCCTGGTCATCAACACCCTCATCATCACCACCACCCTCAGCAGAGGGATTGGCTCCAATGTCCACATCAACTGCTCCTTGAACG
ACCCAATGGCCATCGACTTCCCAGAGCACGCCGTTCTCCAGCTCCCTGTAAGGGAACGAATCCGACAGAAGCTCGTCGCCGGAAAGCTTGTCCTGGTACA
CGAGCATGGTGCCGCCTCTTGAGATTTCTCCCCCGAAAAAAGAGAAAACCCTAACGAGCTCTGGGGGAGGCAGGGGAGTAGCGGCGGAGAGAGACCGGAG
ATGGCGGCTTCCGCGAGGCAGGGGGAGAGGGCGACCAGCTTCGCCATGGCCTGCAGCCTGCTCAGCCCGCTACGTCCGCCAGAACGGCGCCGNCCGCCGC
CGA
page-top