Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25392  (registered. 2007)
Contig Information
Length 1363 bp
Clones 222 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 8
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 30
Wh_KMV Shoot grown with continuous light after cold treatment 8
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 5
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 11
Wh_V483 Shoot grown under cold condition for 3days 27
Wh_VABA Shoot with ABA treatment 10
Wh_VHS Shoot with heat shock treatment 90
Wh_VWD Shoot grown with dessication 23
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit [Triticum aestivum] >gi|11990903|dbj|BAB19815.1| ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit [Triticum aestivum]
Score 798
Evalue 6.6932e-83
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25392
GTGCCGCGGCATCCTCCTCTCCTCCGATAATACAATACCATGGGCCCCCGCCGTGATGGCTTCGTCGGCTACCACCGTCGCACCCTTCCAGGGGCTCAAG
TCCACAGCCGGTCTCCCCGTCAGCCGCCGCTCCAGCGGCAGCCTCGGCCGCGTCAGCAATGGCGGAAGGATCAGGTGCATGCAGGTGTGGCCGATTGAGG
GCATCAAGAAGTTCGAGACCCTGTCTTACTTGCCACCCCTCTCCACGGAGGCCCTCCTGAAGCAGGTCGACTACCTGATCCGCTCCAAGTGGGTGCCCTG
CCTCGAGTTCAGCAAGGTTGGCTTCGTCTTCCGTGAGCACAACAGCTCCTCCGGGTACTACGACGGTCGATACTGGACAATGTGGAAGCTGCCTATGTTC
GGGTGCACCGACGCCACGCAGGTGCTCAACGAGGTGGAGGAGGTCAAGAAGGAGTACCCTGACGCCTATGTCCGCGTCATCGGCTTCGACAACCTGCGCC
AGGTGCAGTGCGTCAGCTTCATCGCATTCAGGCCACCGGGTTGCGAGGAGTCTGGCAAGGCCTAAACTACGAGTTAAAACAATGGCCTATGTATGATTGT
CTTTTGTGAACTTCACTTTTGTCCAGGACTCTGCTTCCCGACCAGAGCATATTTTTCCTTCGGTATGATCTGTGTTTGTACGAACATAGGTTGTGGAGCA
TGCATATGTAAATTCTAGCACCGGCTACAGCATATACAACACCCAGTGTGATATTTATTATATACAACAAGCGGACCATTGTCCTGCTGTTAAAAAAAAA
AAAAAAAACNNCNNGGGGGGNCCNGGTACCNANNTCNCCCNNAATGGANNNTGNTTANNCNNCCTNTGTGNCNATGCTTTNANANCACGCAGGTGATCAA
CGAGGTGGAGGAGGTCAAGAAGGAGTACCCTGACGCGTATGTCCGCATCATCGGATTCGACAACATGCGTCAGGTGCAGTGCGTCAGCTTCATCGCCTTC
AAGCCACCGGGCTGCGAGGAGTCCGGCAAGGCCTAAACAGCTCACTCACGACAGGCCATATATAAAGTGCCATTGCAGTTTTGTCAACTCTGACATTGCT
TTGGGTTTTCCTTCTCCATTAAAAAAAAATTATGATAGAAGTTTGTACCACTCGAATTTGTATCTCTGTTTTTTTAGCGCCGCGGGTTAGAGCTTAGAAC
ACGGTTCAGTGGTTTGTTATCCTTTCTGGAAGAGGCTTCTGCTCGCACTCATGTTGTAACATTGTAATGTGATGTAATTTTGCAGATGTTTTGCTGTTTC
AAGAAATAACCGGTTCTGAACTCACTGTTTGCCAATGTTGTTTATTTTTCTTTAAAAAAAAAA
page-top