Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12054  (registered. 2012)
Contig Information
Length 1211 bp
Clones alternative view 19 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 4
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig12054
TTTTTTTTTTAAAAAATTATTATACCATTGACATTACAACACATCACACCGCAAGCTATCTTGGGCCTAGCCCAGTTCTGATGCATTTTCAAAGCAACGT
GCAATGTTATAGGAGCCCAAAATATGATATTGCTAATATTACAAGCATTCATTCTAGCAATACATACTTTACATCCCAGGAACAGTAAGTGCCAAACAAA
ACTATTCTAAGAAAAAGACAATTAGAACAGAAATTTAGACGATAAGACATAATAGAAGTTCCTATTGTCCTCCTCCTTCAACATTTGAAAGCCTCATTCA
CCAGCTACAAAAGTAAGAGGTTCATATGCTCCATGAACTGGAGGGAATATACAGGATGGCAGTTGTGTAGTAGCTAGGGACGAGGAGGATGAGCTTGGCC
CCATTTTACCTTGTTGCAGACGTTGTTACAGATGCCGTCGTCCTTCTTGTGGGTGTAGCGGCCGGTCTCAGGCATCATCACGGCCAGGAGGAACCCATCG
TCAGAGCAGACAAGGGGCGTGGGGTAGGAAGCCCTCCAACTCCAAGTCGGCCACACGCGGGGTGGGGCCTCCTCCAATGGAGTCCGCGGGGTGACGGAAC
CGCGCCCGCCTGGACTCCATGTCTGAAGGAGCATGGAACACGGTGTCACAATTCCTCTTCTGCCTCTCACTGCCAATTGGTGCCGCTTCCAATTGGCCTG
CTTCAAAATTTGACTGACAGATGCTTCAAACCTCCATGAAGAGGTCCAGATGCTCCATGAACAGGAGGGAGTATGCAGGACGGCAGTCGTGTAGTAGCTA
GGGACGAGGAGGATGAGCTTGGTCCCATTGTACCTGGATGGTAAACAAGAAAACAAGTTATGGCAGCAGAAACATCATGATTTATTCTTTATTAGAGGGA
TGGTGCAAGATGGTCTAGCTACTACAATACGAGGTTGCCAATTGACAATAAGCTCAATTTAACAACACATGATTTTGATATATTTATACGGTTCATAAGG
TCAGCTGACTATTAAGGGCTTCCCCTTAGATTAAAAACAATTATGTGTACCAAGGCAATTCAACATTTAAGTTGAAGGTGTTCGGTAGCAAAACAGAACA
TGATAGATACTAAACAACTTGAACTGGTAATACACAACTAAATTGGCTTTTAAGCAAGTTCAGGTTTCTTATGCAAACAAGGATGAGAGATCTGCTCCTA
AAATAACAATG
page-top