Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25390  (registered. 2007)
Contig Information
Length 1392 bp
Clones 212 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 24
Wh_DPA20 Seed DPA20 15
Wh_EM Dormant seed with water absorption 1
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 6
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 7
Wh_KMP Shoot grown under continuous light 10
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 18
Wh_OKCS Seed DPA5 19
Wh_PCDAM Anther at meiosis 12
Wh_RDr Root of dessiccated seed 11
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 9
Wh_V4816 Shoot grown under cold condition for 16days 11
Wh_V483 Shoot grown under cold condition for 3days 7
Wh_VABA Shoot with ABA treatment 3
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 41
Wh_VWD Shoot grown with dessication 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Glyceraldehyde-3-phosphate dehydrogenase, cytosolic >gi|18978|emb|CAA42901.1| glyceraldehyde 3-phosphate dehydrogenase [Hordeum vulgare]
Score 1630
Evalue 2.2828e-179
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25390
TTTTTTTTTTGGAAGAGAAATAAGATTATTCAGGCAAACACAAGTACTGGACTGAACGATTTATATAATCTTCACAAACCACAACCAAAAAAGAGTACTT
GATTAGCAACTCCATTACAGAAGTACTAGTTGATGCGGAAAACAGAAGGTAACTCATGTCCAACTAACATGAACCAGGCGTCGTCTGGCGACACCATCCA
CATTTATTCTTCGCATAGACAAAGCAGGGACACCTCTGACCAAAGGAAATCAGAACGCTCTACTGAGTCTTGGCCATGTGGCGGATCAGATCGACAACGC
GGTTGCTGTAACCCCACTCGTTGTCGTACCACGAGACGAGCTTGACGAAATGGTCGTTCAGAGCAATTCCAGCCTTGGCATCAAAGATGCTCGACCTGCT
GTCACCGACAAAGTCAGTGGAGACCAAATCTTCCTCGACATAACCCATGATCCCCTTGAGTTTTCCCTCAGATGCAGCCTTGATAGCCTTCTTGATGTCA
TCGTATGATGCAGCCTTCTCGGTTCTAACAGTGAGATCAACAACTGACACATCCACAGTGGGAACCCGGAAAGACATACCGGTAAGCTTGCCATTCAGCT
CAGGAAGAACCTTGCCAACAGCCTTGGCAGCACCAGTGCTGCTGGGAATGATGTTAAAGCTTGCGGCCCTGCCACCTCTCCAGTCCTTGCTCGAGGGACC
ATCAACGGTCTTCTGTGTGGCAGTGATGGCATGAACAGTGGTCATCAAACCCTCAATAATACCGAAGTTGTCATTAATGATCTTTGCTAGGGGAGCAAGG
CAGTTAGTGGTGCAGCTAGCATTTGAGACAATGTTAACGTCTGAGGTGTACTTGTCCTCATTGACACCAACCACAAACATAGGGGGCATCTTTGCTTGGG
GGCAGAGATGACCACCTTCTTGGCACCACCCTTCAAGTGAGCAGCGGCCCTTGTCCTTGTCAGTGAAGACACCGGTGGACTCCACAACGTAATCGGCACC
AGCCTCACCCCACGGGATCTCCTCAGGGTTCCTGACGCCGAAGACGGTAACTGGCTTCTCGCCAAAGAGCAGCGTCTTGTCGTCCTTGAGCTTGATGTCA
CTGTGCTTCCAGTGGCCGTGAACGGTGTCGTACTTGAACATGTAGGTCATGTACTCGGTGGTGATAAAGGGGTCGTTGACGGCGACGAGCTCGACATCGT
CGCTCTGGAGGGCGACCCTGGCGACGAGCCTCCCGATCCTTCCGAAACCGTTGATTCCGATCTTAATCTTGCCCATGGCGAGGGAGTGGAACTGCCGCTG
CGACGCGAGACGGGGATGGGAGGTTGGCTGGGGACGGGACGGGAGAAGTGTCTGGAAGCTGATATGGAGAGGTGGGGAGGGTTAAGCCGCTG
page-top