Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25382  (registered. 2007)
Contig Information
Length 1585 bp
Clones 205 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 25
Wh_DPA20 Seed DPA20 3
Wh_EM Dormant seed with water absorption 23
Wh_EMC Dormant seed with cold treatment after water absorption 18
Wh_EMI Dormant seed with water absorption after breaking 23
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 5
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 13
Wh_OKCS Seed DPA5 10
Wh_PCDAM Anther at meiosis 6
Wh_RDr Root of dessiccated seed 23
Wh_SHC Shoot grown with cold treatment 12
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 24
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein [Bromus inermis]
Score 939
Evalue 2.95684e-114
Total Hit Count 451
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25382
TATGTTTCAGGCCAATGGCTCTCACTCCTTTATCCATTCCTAGCTAGGCACCCCGTATAACAGCCTGATCTCGGCATGTAAGGGATTAATAATATTCTCC
AATCTCCCTGCTCCACATACTTTTACCTCTCCCCCAACCACCAGTGTTTGGTTCAGGGTGGAAAGCGCCATCAATATTAATCTTCAGTTCATTCTCCATT
GGAGGGATCCATCTGATGTGTACCCTCTCCAGTTTGTTTTATAGGTTGTTTTTAATCTTACTTCAAATGTCAGCCAAAGAATGATTGTTTTAGTTATCAC
CTAGTAAACCATGCACCAGAGTCCATCAGCCTTGCTAGGAAGATACAGGAGCTTCCATCAAAAGGCTTGAAACCATTATATCAAGAATGCCATGTTCTTC
ACCGTCCGAGGTTTTTCAAGTGCATGAATATTGGCACTGCCCGCAATATTCACAAGCAATAGTTCAGATGATTGGCAATGCCATATCAGTGCACAAGGCC
GCCCTCCTCGTGCCGAATTCGGCACGAGGGTCTCGAAATAGCACTTAATAAGGTAAACATCCACATTACATCTAGCAGCAACCACGAGTTCGCAAATCAA
CAAACATCAGGCAAAACTTAAAAACGACGGTTCCAGGAACATAGGTCTATATCCTTGAAGATAACTGGCTATAGCAAAACGACTCAACGCCTCAGAATCA
GGCCTTGGCAGCAGCCTGGGCAGCGGCATCCCGCTTCCTCTGCTCCTCAATGATGGTGAGCTTGATACCCTTGCCCTTGGGGAGGCTCACCCACGGCTTG
GTGCCCTTGCCCGATGGTGAACACGTTGCCCAGACGGGTGGCAAACTGGTGGCCCTGCGCATCCTCAACGTGGATGGTCTCGAAGGTTCCCTTATGCTTC
TCCCTGTTCTTGATCACACCAACACGCCCAGTGTTGCGCCCACCAGTAACCATGACCACATTGCCGACGTCAAACTTGATGAAGTCAACAATCTTGTTGG
TCTCCAGGTCGAGCTTGATGGTGTCATTGGCCTTGATGAGTGGGTCTGGGTAGCGGATGGTGCGGCCATCATAGGTGTTCAGGTAGGGGATGCCCTTCTG
GCCGAACTGGACAGACCTGACCTTGCAGAGCTTGAACTTAGCATCCTCATCCCTGACAGAGTGAAGGCGGAAGCGACCCTTGGTGTCATAAAGAAGCCTG
TAGTTCTCACCAGTCTTGGGAATGGAAATGATGTCCATGAACCCAGCAGGGTAGGTCTTGTCAGTGCGGACCTTTCCATCAACCATGATATGACGCTGCA
TAAGGATAGATTGCACTTCACGGTAGGTGAGAGCATATTTCAGTCTGTTCCTCAGGATGAGGATCAGAGGCAGGCACTCCCTGGCCTTGTGAGGACCAGA
TGATGGCTTGGGGGGCAAAAGCTCCACCAAGCTTGTCAAGCATCCAGTGAGATCGGGGCATTGAGCCTCTTCAGATGCTTCTTCAAACCCCTAGCCATGG
TTGCGAGCTCGGGCTAGGTCGCCGTGCTTCTCCTCTTCGGGCACCGCCGCCGCCTGCTCCTTCTCCTGTTCTACGCGCCGCCGCC
page-top