Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25381  (registered. 2007)
Contig Information
Length 2872 bp
Clones 204 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 5
Wh_KMP Shoot grown under continuous light 6
Wh_KMV Shoot grown with continuous light after cold treatment 18
Wh_MS Seed DPA5 of DT3DL CS wheat 12
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 18
Wh_SHC Shoot grown with cold treatment 19
Wh_SHDr Shoot grown with dessication 12
Wh_V4816 Shoot grown under cold condition for 16days 19
Wh_V483 Shoot grown under cold condition for 3days 23
Wh_VABA Shoot with ABA treatment 16
Wh_VHS Shoot with heat shock treatment 4
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 38
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit methionine synthase 1 enzyme [Hordeum vulgare subsp. vulgare]
Score 2364
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25381
CTCCTCCTCCCCGTTGCTCGCCGCCGTCCCTCTCCGCCTCCGCGCACCCAGGGTAAGCGAGCCCTCTCCCTCCCTCCTCCGTGCACCCGTGAATCCACAC
GCACGAGCGCACGCCGGGCCTCCCCCCTAGATCCGTGCACCACCGGATCGGCTGTCCCGCGCGCTTTGAATGACTATCTGTGTTGGTTATCAGTCGTAGG
ATCGATCGCCCGGCCACCGCCGGCGGGTATCGTCCTCGGCCCGTGTCCCGTAGGCAGCGCCGGTAGGCGGCGCGGCGGAGAGCTCGGCTGCTCTGTTTGC
AGAAAGATGGCGTCCCACATTGTCGGATACCCGCGCATGGGCCCCAAGAGGGAGCTCAAGTTTGCCCTGGAGTCTTTCTGGGATGGCAAGAGCAGCGCCG
AGGATTTGGAGAAGGTTGCCACCGACCTCAGGGCCAGCATCTGGAAGCAGATGGCTGATGCTGGGATCAAGTACATCCCCAGCAACACCTTCTCCTACTA
TGATCAGGTTCTTGACACCACCGCCATGCTCGGTGCCGTCCCAGACCGTTACTCATGGACCGGTGGGGAGATCAATTTGAGCACCTACTTCTCGATGGCT
AGGGGTAACGCCACCGTCCCTGCTATGGAGATGACCAAGTGGTTTGACACCAACTACCACTTCATCGTCCCTGAATTGGCTCCTAGCACCAAGTTCTCCT
ACTCTTCTCACAAGGCTATCAATGAGTACAAGGAGGCTAAGGCGCTTGGCGTTGATACCGTCCCCGTACTTGTCGGACCAGTCTCATACTTGTTACTCTC
AAAGGCCGCCAAGGGCGTAGAGAAATCATTCTCTCCCCTTTCCCTTCTTAGCAGCATCCTTCCCGTCTACAAGGAGGTTATTGCTGAGTTGAAGGCAGCT
GGCGCTTCATGGATTCAGTTTGATGAGCCCACCCTTGTTAAGGACCTTGAATCCCACCAATTGTCTGCATTCTCTGCAGCTTACGCAGAACTTGAGTCCG
CACTTTCTGGATTGAACGTTCTTGTTGAGACCTACTTCGCTGACGTTCCCGCAGACTCGTACAAGACTCTTACATCATTGAGCAGTGTAACTGCTTATGG
TTTTGACCTTGAACGTGGAACCAAGACTCTTGAGCTTGTCAAGAGTGGTTTCCCTGCTGGAAAGTACCTCTTTGCTGGTGTCGTAGATGGACGCAACATT
TGGGCTGATGACCTTGCTGCATCTCTCGCCACTCTTCAGTCTCTCGAGGCTGTTGTTGGGAAGGACAAGCTTGTCGTATCGACTTCGTGCTCACTCATGC
ACACTGCTGTGGACCTTGTAAATGAGACCAAGCTTGATGATGAGATTAAGTCATGGCTCGCATTTGCCGCCCAAAAGGTCGTTGAGGTGAACGCCCTTGC
CAAGGCATTGGCTGGTCAAAAGGATGAGGCTTACTTCGCAGCAAATGCTGCTGCTCTGGCCTCAAGAAGGTCGTCACCACGTGTCACAAATGAGGAGGTC
CAGAAGGCTGCTACTGCTCTCAAGGGCTCTGATCACCGCCGTGCTACCACCGTTAGCGCTAGGTTGGATGCGCAGCAGAAGAAGCTCAACCTTCCGGTCC
TTCCCACGACCACCATTGGATCATTCCCACAGACCGTGGAGCTCAGGAGAGTTCGCCGTGAGTACAAGGCAAAGAAGATCTCTGAGGAGGAGTACACCAA
CGCCATCAAGGAGGAAATTAGCAAGGTTGTTAAGATCCAAGAAGAGCTTGACATTGATGTGCTTGTGCACGGAGAGCCAGAGAGGAACGATATGGTTGAG
TACTTCGGTGAGCAGCTCTCTGGTTTCACATTCACTGCCAATGGCTGGGTGCAATCTTATGGATCCAGGTGCGTCAAGCCCACCGATTATCTATGGTGAC
GTGAGCCGCCCCAACCCCATGACTGTGTTCTGGTCCAAGATGGCACAGAGCATGACTGCTCGCCCAATGAAGGGAATGTTGACAGGCCCTGTCACAATCC
TTAACTGGTCTTTTGTCAGAAATGACCAACCGAGGTTTGAGACTTGCTACCAGATTGCTCTTGCAATCAAGAAGGAGGTTGAGGATCTTGAGGCAGGCGG
TATTCAGGTCATCCAAATTGACGAGGCTGCTTTGAGAGAGGGTCTGCCACTCCGCAAGTCTGAGCACGCTTTCTACTTGGACTGGGCCGTGCACTCCTTC
AGGATCACCAACTGCGGTGTCCAGGACACCACCCAGATCCACACCCACATGTGCTACTCCAACTTCAACGACATCATCCAGTCCATCATCAACATGGACG
CTGATGTGATCACCATTGAGAACTCGCGGTCTGACGAGAAGCTTCTCTCCGTCTTCCGCGAGGGTGTGGTGTACGGTGCAGGCATTGGCCCGGGTGTGTA
CGACATCCACTCCCCCAGGATCCCGTCCAAGGAGGAGATTGCCGACCGTGTCAACAAGATGCTCGCGGTGCTCGACACCAACATCCTGTGGGTGAACCCT
GACTGCGGTCTCAAGACCCGCAAGTACGCCGAGGTCAAGCCTGCGCTCACCAACATGGTTGAGGCCGCCAAGCAGATCCGCGCCGAGCTCGCCAAGGCGC
AGTAAGCCGTGCTTGTATAGCAGCTCCCCACTTTTAATTGCAAGGAGGATGTCACCACCATAGCCGTGTTTACTTTTGAATAATCTGGGTCTCGTATCCA
CTTGTTGGTTAGGCTAGTTTGTTTCTCGGTGCGGCGCGATGTGCTCATCCCTTGATTTGGTGGTTTTTGAGGCGGTTGTCGGTGTGTATTGTAAACTGAG
TGGCGAATTGTTCATCTAAGTCTGAGTTTGTTACGTTATGTTTCAAATTACAAAATTTCTCCAGATGTTCTG
page-top