Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25374  (registered. 2007)
Contig Information
Length 1245 bp
Clones 197 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_KMP Shoot grown under continuous light 26
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 5
Wh_V4816 Shoot grown under cold condition for 16days 11
Wh_V483 Shoot grown under cold condition for 3days 21
Wh_VABA Shoot with ABA treatment 36
Wh_VHS Shoot with heat shock treatment 50
Wh_VWD Shoot grown with dessication 39
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Carbonic anhydrase, chloroplastic; AltName: Full=Carbonate dehydratase; Flags: Precursor >gi|558499|gb|AAC41656.1| carbonic anhydrase
Score 871
Evalue 5.2021e-108
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25374
TTTTTTTTTTCAGTAAGTTTGTATATTGCCTTTAGTCAATTTCGGTTCCTTCAGATATACAGTAGTACAAACTGTTTCTTGGGTTGGGCAAACAGCTAAG
CAGTGCCAGACACAAGACGGAAAACCACAAGGACAAAGGGTAATAAAAGGGGTAAACTGTTCATGAAAATATTATTAAACTTATATATGATGTCTTTTGA
TCACAGGACGATCAAATTATGCATCACACGGGTAGTACAATTCCTCGTCAGAAAATGGTAAAAGAAAAAGGGTTCTATTGCTTATGGCGAATTCACATCG
GGCCATCCCGGCATCCAGTACTGGAAAACAACGAGTACGCACTCCATGGCATTGGATTCACATCGGTCGGTCGGACGATATCTTGATATATGTACGGCGT
TTGCATTCGCATGTATATATAGGAGTTAACCGCTGGGGAAGATTCACTGCTCCCATGTCTCGAACTTGCCGGAGACGAAGTCGTAGTGACCGCCGACCAG
CTTGAGGGTTCCGTTGGACACACCCTCCTTGACGAACGGGTAGGTCAGGAGGTTCTGGAGGGACACGTTCACTGCCTCCTTTTCGAGGACGGTGCACTGG
TCATCGAAAGGCATGGAGGCGCACTCAGTCTGCACCTTCTTCTTGGCCGGGAAGCCGATCCTGACCCAGTCCTCGACGAAGTGGAAGGAGTCGTCTGCGC
CATCCTTGAGTGAGAGCAGAGCCTTGATTCCACCGCAGCGGCTGTGGCCAATCACCACGATGACCTCAACCTTGAGAGCACAGACGGCGTATTCGATGGC
CGATCCAACACCGGCGTACTTGTTCTTGCAGTAGGAGGGGACCATGTTGGCGATGTTGCGGATGGTGAAGGCCTCGCCGGGCTCCAGGCCCAGGGTGACC
GAGGGGCACACACGGGAGTCGGCGCACGCGAACACCATGTACTTGGGGCGCCTGGCCGGCCTTGAGGGGCTCGAAGAAATCGGGCTTCTTGTCGTAGACC
TCGGTCTTGAACTTCTCGAACCCGGTCTTGAGGCGCTCCACGGCGGCGTCCATCAATGCGGGTGCGACGGGGGCGGCCTGGATCGGGGGTGTTCCTGATG
AGCTTGGGGCGGAAGGAGGAGGAGTTGGAGGGCGCGGGGGTGCCGAGGCTGGCGATCGATGGTGGAGGAGCGGGCACCGGGGCGCGACTACGGTTGCGTA
GCACCAGTTAGCCGCGGCGGTCGACATTGCGGCACGAGGCCTCGT
page-top