Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25371  (registered. 2007)
Contig Information
Length 1643 bp
Clones 191 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 29
Wh_DPA20 Seed DPA20 9
Wh_EM Dormant seed with water absorption 16
Wh_EMC Dormant seed with cold treatment after water absorption 5
Wh_EMI Dormant seed with water absorption after breaking 12
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 5
Wh_KMP Shoot grown under continuous light 8
Wh_KMV Shoot grown with continuous light after cold treatment 6
Wh_MS Seed DPA5 of DT3DL CS wheat 10
Wh_OKCS Seed DPA5 16
Wh_PCDAM Anther at meiosis 13
Wh_RDr Root of dessiccated seed 6
Wh_SHC Shoot grown with cold treatment 15
Wh_SHDr Shoot grown with dessication 6
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_V483 Shoot grown under cold condition for 3days 16
Wh_VHS Shoot with heat shock treatment 4
Wh_VSCB Liquid cultured tissue 9
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|170776|gb|AAA34306.1| translation elongation factor 1 alpha-subunit >gi|949878|emb|CAA90651.1| elongation factor 1-alpha [Hordeum vulgare subsp. vulgare]
Score 1935
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25371
TAAAGAAGCATCTTAACAGGCAACCATTTGGCAAAAGCAGCAGAAAAACAAGCTAACAAGTTGCAATCTAATAACTTGCATTTCACAACAAATCAGTCTC
AGGGGCACAGGCAGTTTAGCCGACGCAGGAATAGAAATACAGTAATTAAACGACAGACAGATCATTGCTCGCTCGGGATAAGAGTCTGAAGCAACAAAAG
CAATGACCGTGAACAAAAACATTCTGCTAGATAGCACGCCTATTTCTTCTTGATGGCAGCCTTGGTAACCTTGGCGCCGGTGGGGTCCTTCTTCTCCACG
CCCTTGATGACACCAACAGCAACCGTTTGTCTCATGTCACGCACAGCGAAGCGGCCAAGAGGAGGGTAGGTGGCGAAGGTCTCCACAACCATGGGCTTGG
TGGGAATCATCTTGACGATACCAGCGTCACCGTTCTTCAGGAACTTGGGCAGCGCCTCCAGCTCCTTACCAGATCGCCTGTCGATCTTGGTCACCAGCTC
AGCAAACTTGACAGCAATGTGGGAGGTGTGGCAGTCCAGCACTGGGGCGTAGCCATTGCCGATCTGACCAGGGTGGTTCATGATGATGACCTGGGAGGTG
AAGTTGGCCGCCTCCTTGGCAGGGTCATCCTTGGAGTTGGATGCAACAAACCCACGCTTCAGATCCTTCACAGCAACGTTCTTGACGTTGAAGCCAACGT
TGTCACCAGGAAGCGCCTCCAGGAGAGACTCATGGTGCATCTCAACAGACTTAACCTCAGTTGTCAGACCAGTGGGGACCAAAGGTAACAACCATACCAG
GCTTGATGACACCAGTCTCAACACGGCCAACAGGCACAGTTCCAATGCCACCAATCTTGTAAACATCCTGAAGGGGAAGACGCAGGGGGCTTGTCTGAGG
GCCTCTTGGGGCTCATTGATCTGGTCAAGAGCCTCAAGAAGGGTAGGGCCCTTGTACCAGTCAAGGTTGGTGGACCTCTCAATCATGTTGTCACCCTCAA
ACCCAGAGATGGGAACGAAGGGAACCTTGTCAGGGTTGTAGCCGACCTTCTTCAGGTACGAAGAGACTTCCTTGACAATTTCCTCATAACGGGCCTTTGA
GTACTTGGGAGTGGTGGCGTCCATCTTGTTGCAGCAGCAGATCATCTGCTTCACTCCAAGGGTGAAAGCAAGGAGGGCGTGCTCACGGGTCTGGCCATCC
TTGGAGATACCAGCCTCAAAACCACCAGTGGTGGAGTCAATGATGAGCACAGCACAGTCAGCCTGGGAGGTACCAGTAATCATGTTCTTGATGAAGTCAC
GGTGACCAGGGGCATCAATGACGGTGCAGTAGTACTTGGTGGTCTCGAACTTCCACAGGGCAATATCAATGGTGATACCCCTCTCACGCTCGGCCTTCAG
CTTGTCAAGCACCCAGGCGTACTTGAAAGACCTCTTGTTCATCTCAGCGGCTTCCTTCTCAAACCTCTCGATCACACGCTTGTCAATACCTCCAAGCTTG
TAGATCAGATGGCCAGTGGTTGTCGACTTGCCAGAGTCGAGCATGGCCAATGACCACGATGTTGATGTGAGTCTTCTCCTTACCCATGGCTGGAGCTCCG
AGGAAGGAGAAGGAACCGAGAGGAGGCGGCGGCGGGGATGGGG
page-top