Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25333  (registered. 2007)
Contig Information
Length 1797 bp
Clones 139 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 5
Wh_DPA20 Seed DPA20 3
Wh_EMC Dormant seed with cold treatment after water absorption 12
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 6
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 6
Wh_KMP Shoot grown under continuous light 8
Wh_KMV Shoot grown with continuous light after cold treatment 8
Wh_MS Seed DPA5 of DT3DL CS wheat 10
Wh_OKCS Seed DPA5 17
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 17
Wh_SHC Shoot grown with cold treatment 3
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 13
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 6
Wh_VHS Shoot with heat shock treatment 7
Wh_VSCB Liquid cultured tissue 10
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glyceraldehyde-3-phosphate dehydrogenase [Triticum aestivum]
Score 1636
Evalue 6.4246e-180
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25333
GCAGACTAGGATCAATTGCAAGAACCAGAAGCATCATTGTTTCAATATAAACTATAATATCTTGTTTGCATTTGAAGAAAATCAACTTTTCATCCCATCT
GTATGGCAGTTGTGTAGTGAGTTTCCTATAGTTCCTCCAACAGAAGCTCCATATTCAGTTTTTGTGACTGATCGGACCTTGCAAAGAAGAGAGCCGAGTA
GACGTACCCTTCCTGTAACAAATCATTGTGATTTTTTGTGCTACACCTTTAGATGGAAAAAGGGGGGAAAGAGCGAAATTTCGAGACAGAGTTTTCAAGA
CAAGGTTAGTGCATGAATGATATTTTTGTTGAAAGGATCTGAAAGATGTGTCAAAAGGTTCTCAATGGGCCCAGCGTGAGTCACAGACGCTTGCACAATA
AAGCCAAGCATAGCAACCATTGCCAACCTCCCATTCTTAATTTCTTTCAGCTTCACTTCATTCGCAGAGTAGCCGTCCCAATCCTCGATCTGTTCTCAGA
CCCTCCTCCGTCCGTCGCAGCTCCAGATTTCCTTCCCCATGGCTCCGATCAAGATCGGTATCAACGGTTTCGGCCGGATCGGCAGGCTTGTGGCCAGGGT
TGCGCTCCAGAGCCCCGATGTCGAGCTCGTCGCCGTCAACGACCCCTTCATCACCACCGACTACATGACCTACATGTTCAAGTATGACACTGTCCACGGA
CAGTGGAAGCACCATGAAGTTAAGGTGAAGGACTCCAAGACCCTTCTCTTCGGTGAGAAGGAGGTTGCTGTGTTTGGCTGCAGGAACCCTGAGGAGATCC
CATGGGCTGCTGCTGGTGCTGAGTACGTTGTTGAGTCCACCGGTGTTTTCACTGACAAGGACAAGGCTGCAGCTCACATTAAGGGTGGTGCCAAGAAGGT
CATCATTTCTGCTCCCAGCAAGGATGCTCCCATGTTTGTCTGTGGTGTCAATGAGAAGGAATACAAGTCTGACATCGACATTGTCTCCAACGCTAGCTGC
ACCACTAACTGCCTTGCTCCTCTTGCTAAGGTTATCAATGACAGGTTTGGCATTGTTGAGGGTTTGATGACCACAGTTCATGCCATGACTGCAACCCAGA
AGACTGTTGATGGTCCTTCCAGCAAGGACTGGAGAGGTGGAAGGGCTGCCAGCTTCAACATCATTCCAAGCAGCACTGGTGCCGCAAAGGCTGTTGGCAA
GGTGCTCCCAGAGCTTAACGGAAAGTTGACTGGAATGGCCTTCCGTGTTCCCACTGTTGATGTTTCTGTTGTTGATCTGACTGTTAGACTTGCGAAGCCA
GCAACCTATGATCAGATTAAGGCTGCTATCAAGGAGGAGTCTGAGGGAAACCTCAAGGGCATTTTGGGTTACGTTGATGAGGACCTTGTTTCCACTGACT
TCCAGGGTGACAACAGGTCCAGCATCTTCGATGCCAAGGCCGGGATTGCTCTGAACGACAACTTTGTCAAGCTTGTCTCCTGGTACGACAACGAGTGGGG
ATACAGCACCCGCGTGGTCGACCTCATCCGTCACATGCACAGCACCAAGTAAATGAGAGGCATACAGGGGAGAGTGGTTTGCCCCAGAGGAGTGTTCAAA
GCCTCTTCTTCTGAGAATAAATTTTTGTATGGAATTATGTCAGCTAAAAACCTTTTATTGGATGTATCCTGATGGTTGGTTGGGCTTAGCGGCTCACATT
TTGGTGGTATTATGTACTTGCTTGAACTAAATCATGAGTCATTTTCACTCATCTTCTTGGGTTATCAATCACATGTCGTTTTGTTCTAAAAAAAAAA
page-top