Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25317  (registered. 2007)
Contig Information
Length 1183 bp
Clones 123 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_RDr Root of dessiccated seed 28
Wh_SHC Shoot grown with cold treatment 18
Wh_SHDr Shoot grown with dessication 37
Wh_V4816 Shoot grown under cold condition for 16days 5
Wh_V483 Shoot grown under cold condition for 3days 9
Wh_VABA Shoot with ABA treatment 6
Wh_VHS Shoot with heat shock treatment 1
Wh_VWD Shoot grown with dessication 10
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cold acclimation protein WCOR410c [Triticum aestivum]
Score 536
Evalue 1.31406e-52
Total Hit Count 147
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25317
TGTACGCTATATATCTTCACAAAATGCAACAATATGTACTGGGCGGAAATCTTTAATATCAAGGCATAATGCCCAGCAAATAACCAATACACAAGCGCCC
ATAATAAGTAAACAAACTTAACAACATCCAGGACCTGACTCTGAACCAAACTGAAACACAAGCATCCGTCACTGAACGGGCTTCACGGACCGAACCTTCA
AAGACGATCAACCCCTCCCACCTTGACACCAACTTAACGTAAAGCAAACACAACACACGCCAACAATTCAATCGAGGTCCGGTCACGAGTCTCGGGCACG
GCGGCGATCAAGCGCTGGGCTTGTGCTCGCCTGCAGCGGCGGCGGCCTTGTCCTCCTCCCCTGTCTTGTGGTAACCAGGCAGCTTGTCCATGATCTTGCC
CAGTAGGCCCTTCTTCTCCTTCGCGTCAGGGCTGCTCACCTCCTCGGCGGCTGGCGCCGGCGCGTGCACTGGTGCTGGAGCAGCGTGCGTGACGGGCACC
GGAGCAGCGTCCTCCGGTTTCTTGTGGCCGCCGGGCAGCTTCTCCTTGATCTTTTCCAAGAAGCCTTTCTTCTCCTCCTCGGGCACTGCCGGTGCCGCCT
CTGTCTTCACGTCACCGTCGATCTTTTCGACGACGACGTCGGTGTCATGGTGGGTCTGCACAGACGCGGGGGCCGCCGGTGCGGGTAGGCCCGTCACGTG
CTCACCCTCGGTGTCCTTGTGGCCGGGCAGCTTCTCCTTGAGCTTCTCCTTGAGACCCTTCTTCTTCTTCCTCTTGATCACCTCACCGTTGTCATCGATC
ACCTCCTCCTCTTCCTCGTCACTAGACGAGCTGGAGCTGGAGCTGGATCGGTGCAGCTTGGAGAAGAGGGTCTCCTTCTTCTCGCCATCCTCGTGCTCCT
CCTTCTTAACCTCGGGCTCTTCCACGGAGACCTTCTCCATGCCGGTGACCAGCTCCTCCTGCTTCTCCTTGTCCTCCTCCGCCTTCTTCTTGCCGAGGAG
GTTGCCGAGGAGGCCCCTGTCTGTCACCTCCACCTGCTCGGCGGCCTCACCTCCCTGGTATGACTGGGTGCTCCTCTCATCCTCCATGATCGAGATCGAT
CGGTGCAGCTAAAAGGTCTTCCGGGAGCTAAAGAAAACAACAGATCAAGTATTGGTTCTTGGCTTGTGGCTTTTGCTTGGCCG
page-top