Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig25307  (registered. 2007)
Contig Information
Length 1139 bp
Clones 114 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 9
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 6
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 11
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 6
Wh_KMP Shoot grown under continuous light 7
Wh_KMV Shoot grown with continuous light after cold treatment 5
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 9
Wh_RDr Root of dessiccated seed 10
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 8
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 4
Wh_VHS Shoot with heat shock treatment 6
Wh_VSCB Liquid cultured tissue 7
Wh_VWD Shoot grown with dessication 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0529600 [Oryza sativa (japonica cultivar-group)] >gi|32352138|dbj|BAC78562.1| thiamine biosynthetic enzyme [Oryza sativa Japonica Group] >gi|113611377|dbj|BAF21755.1| Os07g0529600 [Oryza sativa (japonica cultivar-group)] >gi|215712225|dbj|BAG94352.1| unnamed protein product [Oryza sativa Japonica Group]
Score 451
Evalue 8.88817e-43
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig25307
TTTTTTTTTTAGAACTCAACCTTTTTATTCCCTCCTCTTGTTCCAGAAGGATTCATCATCCATGGAACTGGCCGCGAGGCAGAGGCAGGGCAGAGCACAT
GGCGGGCAGGTGGCATGAACAAAATACGCTAACACAAGAAAACTAAAGACAAACATCGGAATTAAACACGAGTCTGACAAATCACAAAGACAAGCCCTCG
TCCCTAAGCATCCTCCGTTTCACCGAACCATCTTATTGATCTTGCGCCCCCAAACACCAGCGTACGTACGCCTTGGTGTCCGTGGCTCATTGCTTTGCTT
AGGCGTCCACGATGTCGCCGTTGTTGGTCGCCGCCAGGATCATCTCCGGGTGCAGCGCCGGGGTCACGTTCTTGAGCGTCCCGTCGATGCCGTTCGGCCG
GCCGAGGGCCTTGAGCGCCAGGTGCGCCGCCTTCTGGCCGGAGATCATCATGGCGCCGAAGGTCGGGCCCATTCTCGGGGCGCCGTCGATCTCGGCGACC
TCCATGCCGGTGACAATCATGCCGGGGACAACCTCGCGGGTGAGGCGCACGATGGCATCCTCGGCCGTGTTCATGTCGAGCGCCTTCATCCCGGGCACCG
CCTGGATCATGCCGATGTCCTGGAGCCGAAAGAGCAGGATCTTCTATATCTTCTGGTCTCCTGACACCGCAAAGGTGAGGAGCAAGATGACGTACGCGAG
CACCAACGAGAAGTTCAAGAGGACCCTGGACGGCATCCAGATTGAGATGCAGGCCACTGACCCGAGCGAAATCAGCCTGGACGTGATCAAGGAGCGCGCG
CACTAAGGCAAATCATCCCAATGCCTCGCAATATGGATTTATGTCAACTATAGATTTGGCGGTGTGACTCTTGAAACTTTCTTGATGATTTGTGGCTTTG
TTACCGTGTCGAAAGGCCCTCCTCCCGTGGTCCGTGAGACCACGGAGGGCTTGCTCTATCATGTAATCTGTTCTTTTTCCTCTGCCCATTTATATGCCGG
GCCTTATGCTGCTGCACTGCACTGTTCTTCCAAGTTACGGTTATAAATAATCAAATGTTCTGTTTGGATTCGTCACAAGGCTGGTGTGTAATTCAGCATG
GCAGTCTATCTGCATATCTGTTGGATATGATCTCTACCG
page-top